Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

... with these valves. We descr ibe distortion of the bioprosthesis ring as a risk factor for early calcification.Methods: A total of 510 patients over the age of 70 years underwent isolated aortic ... valves [3]. We describe distortio n of the bio-prosthesis ring as a risk factor for early calcification.Materials and methods A total of 510 patients over the a ge of 70 years under-went isolated ... possible relationship between early bioprosthetic calcification and radiologic distortion of the bioprosthesis ring. As the population ages, bioprosthesis are increasinglybeing used in cardiac valve...

Tài liệu Báo cáo Y học: Solution structure of the mEGF/TGFa44250 chimeric growth factor doc

... to the set of distances. The main advantages of the procedure are simple: the details of the calibration are precisely and unambiguously deﬁned,it is fully automatic, and the family of calculated ... H., Komurasaki, T., Uchida, D., Takayama, Y. , Isobe, T.,Okuyama, T. & Hanada, K. (1995) Epiregulin. A novel epidermalgrowth factor with mitogenic activity for rat primary hepatocytes.J. ... expected for a given structurecan be calculated approximately from the exponential of the matrix of theoretical cross relaxation rates. These valuesmay be replaced by scaled experimental values and...

Báo cáo y học: "Decreased levels of the gelsolin plasma isoform in patients with rheumatoid arthritis" docx

... however,hypothetically accommodates dysfunctional and destructiveactions of the mediators, leading to secondary organ damageand even death.This set of events is theoretically also applicable to ... defined as the loss of cortical definition of the proximalinterphalangeal, metacarpophalangeal, carpal, interphalan-geal, and metatarsophalangeal joints was documented: a sin-gle erosion was defined ... in plasmaand SF in the matched pair of samples. Mechanistically, pGSNmay be consumed locally through trapping at the joint spaceor other affected organs in order to maintain a steady-stateconcentration...

Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

... propionyl-CoA carboxylase; AAC, ATP/ADP translocator; ACP, acyl carrier protein; ALAT, alanine aminotransferase; BC-AAT, branched-chain amino acidaminotransferase; C I, complex I; ECH, enoyl-CoA hydratase; ... 3-hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrierprotein; Pyr C, pyruvate carboxylase; SCS, succinyl-CoA synthetase; ... findstaxonomic home. Nature 1996, 380:398.4. Arisue N, Hashimoto T, Yoshikawa H, Nakamura Y, Nakamura G,Nakamura F, Yano TA, Hasegawa M: Phylogenetic position of Blastocystishominis and of stramenopiles...

Báo cáo y học: "Primary leiomyosarcoma of the right atrium: a case report and literature updat" ppsx

... surgery the right atrial appendage was noted to be verycongested and “angry looking” . Total cardiopulmonarybypass was established using aortic and bi-caval cannula-tion. The right atrial cavity ... adjuvant multimodality therapy along with a tumorsurveillance program may improve survival.IntroductionPrimary cardiac malignancies (PCM) are rare. The preva-lence of primary cardiac malignancies ... cardiactumors are a 100-fold more common than primarylesions. The majority of Primary Cardiac tumors arebenign (with half of them being myxomas) [4] andapproximately 25% of primary cardiac neoplasms aremalignant....

Báo cáo y học: "Papillary fibroelastoma of the aortic valve - a case report and literature review" pptx

... papillary fibroelastoma of the aortic valve in a youngwoman -a case report. Cardiovascular Ultrasound 2009, 7:43.9. Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report of a surgical case ... twocases and review of the literature. Annals of Clinical & Laboratory Science2001, 31(3):291-296.8. Parthenakis F, Nyktari E, Patrianakos A, Pitsis A, Asimaki A, Vardas P:Asymptomatic papillary ... strategiclocation and variable mobility of the tumour mass duringvarious phases of cardiac cycle (Figure 2 and 3). Therefore,this could be considered as angina-like symptom.Thediagnosisisusuallymadeby2-dimentionalortransoesophageal...

Báo cáo y học: "Intraneural hemangioma of the median nerve: A case report" pot

... consent was obtained from the patient for publication of this Case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.References1. ... Flowvoids are usually apparent and feeding vessels may be vis-ualized; these lesions are also noted to enhance after Gd-addition. On angiography an early and persistent tumoralblush is demonstrated ... http://www.jbppni.com/content/3/1/5Page 2 of 5(page number not for citation purposes)Here we present a case of intraneural hemangioma of the median nerve of a 14-year-old female removed surgicallyby combined interfasicular and...

Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

... Mathematically this was achieved byintroducing a Ôfree mixing factor ( fm) to the rate equation for exogenous arginine hydrolysis by arginase in the Mathematica program; fm can take any value ... andnecessarily complex, mathematical models serves as a ÔtoolÕto facilitate analysis of channelling in biochemical pathwayslike the urea cycle.There is a range of possible molecular mechanisms thatmay ... in the matrix. Since the speciﬁc activity of the carbamoyl phos-phate produced in the matrix is the same as that of the bicarbonate, only small changes are predicted in the distribution of labelled...

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... GAAAGTCTGGGAAGAGGTGACTCCACAS: CAGTGTTGGCTGAGTGAAAGAGACCC284Osteocalcin S: CATGAGAGCCCTCACAAS: AGAGCGACACCCTAGAC310 [48]Alkaline phosphatase S: TGCAGTACGAGCTGAACAGAS: TGAAGACGTGGGAATGGTC267Type I collagen ... and particularly during inflammatoryphases. Very often, these phases lead to hyperplasia of the synovium, which may invade the joint space and adhere to car-tilage, generating a pannus. This ... Investigator Award from the Canadian Arthritis Society. This study was supported by grant TAS 01/0033 from the Canadian Arthritis Society and by grant MOP-64401 from the Canadian Institutes of Health...

Báo cáo y học: "Anticancer Activity of the PR Domain of Tumor Suppressor RIZ1"

... quan-titatively analyzed the mRNA expression level of RIZ1 over the disease progression in eight different types of cancer, and evaluated the anticancer activity of the PR domain against human hepatoma ... apoptosis in the early stages and a tumor promoter to induce me-tastasis in late stages. If this hypothesis were proved valid, the net result of RIZ1’s apparently conflicting function at early and ... Cancer Research Society of Canada. W. Sun would also like to acknowledge the College of Phar-macy and Nutrition, University of Saskatchewan for the awarding of a graduate scholarship. Int. J....

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ