Báo cáo y học: "CLOCK is suggested to associate with comorbid alcohol use and depressive disorders" ppt
Báo cáo y học: "Line bisection performance in patients with generalized anxiety disorder and treatment-resistant depressionLine bisection performance in patients with generalized anxiety disorder and treatment-resistant depression"
... predominance and risk-taking in healthy university students has also proven by studying the line bisecting performance and Zucker-man’s sensation seeking scales in Drake and Ulrich’s study 36. ... 2010; 7(4):224-231 â Ivyspring International Publisher. All rights reserved Research Paper Line bisection performance in patients with generalized anxiety disorder and treatment-resistant depression ... negatively correlated with Disinhibition-Seeking in the healthy subjects, and with Total sensation-seeking and Experience-Seeking in GAD patients, while the Magnitude of the line bisection...
- 8
- 572
- 0
Báo cáo Y học: The amyloid precursor protein interacts with neutral lipids Liposomes and monolayer studies pdf
... Therefore, alteration of the charge of the protein could be induced at the vicinity of the monolayer. Adifference in the orientation of the protein moiety during the insertion process into the ... the protein were probably affected by electro-static interactions with the lipid layers. Our results indicatethat the penetration of the protein into the lipid monolayer isalso influenced by the ... amount of the protein present at the interface. In other words, increasing the ionic strength has the same effect as an increase of the protein hydrophobicity.As the hydrophobic nature of the interaction...
- 9
- 436
- 0
Báo cáo y học: "Giantin is the major Golgi autoantigen in human anti-Golgi complex sera" pptx
... from the Golgi membrane into the cytoplasm. Ourworking hypothesis is that aberrantly expressed Golgi complex autoantigens may be released into the immune system whencells undergo lysis. By virtue ... prominent function in the processing, transport-ing, and sorting of intracellular proteins subsequent totheir synthesis in the rough endoplasmic reticulum. Struc-turally, the Golgi complex is ... autoantibody probes. These Golgi autoantigens are referred to as giantin/macrogolgin/GCP372, golgin-245/p230, golgin-160/GCP170,golgin-95/GM130, golgin-97, and golgin-67, with theirnames based in...
- 8
- 342
- 0
Báo cáo y học: "Remission by composite scores in rheumatoid arthritis: are ankles and feet important" pptx
... assessment in RA. In this study, we showed that theassessment of joint activity in the feet, beyond assessment ofjoint activity by the 28-joint count, does not convey significantadded value in the ... that while providing useful and important clinical information, the inclusion of ankles and feet only rarely influences the definition of overall disease activitystatus, especially the presence ... Joint counts are commonly used to evaluate joint involve-ment and are therefore an indispensable component of formaldisease activity assessment using composite indices.Although principally in...
- 9
- 343
- 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... 51. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M: Mouse Pitx2 deficiency leads to anomalies of...
- 36
- 446
- 0
Báo cáo y học: "CLOCK is suggested to associate with comorbid alcohol use and depressive disorders" ppt
... R:Primary anxiety disorders and the development of subsequent alcohol use disorders: a 4-year community study of adolescents and youngadults. Psychol Med 2003, 33:1211-1222.52. Sher L: Alcoholism and ... 95:195-200.doi:10.1186/1740-3391-8-1Cite this article as: Sjöholm et al.: CLOCK is suggested to associate with comorbid alcohol use and depressive disorders. Journal of CircadianRhythms 2010 8:1.Submit your next manuscript to BioMed ... to serine and associates with theshort chain acyl-CoA dehydro genase deficiency [60] that is characterized by lipid storage myopathy and muscleweakness.An advant age of this study is that the...
- 9
- 419
- 0
Báo cáo y học: "Aortitis requiring aortic repair associated with glaucoma, thyroiditis, glaucoma, and neuropathy: case" docx
... Stöllberger et al.: Aortitis requiring aortic repair associated with glauc oma, thyroiditis, glaucoma, and neuropathy: casereport. Journal of Cardiothoracic Surgery 2011 6:74.Submit your next manuscript ... giant cell arteritis,spondylarthropathy, Behcet’s syndrome, relapsing poly-chondritis, Cogan’s syndrome, retroperitoneal fibrosis,ankylosing spondylitis, systemic lupus erythemat odes,scleroderma, ... major study, it was detected in 9% of 513 patients with surgically resected aortic aneurysms, and more fre-quently in females than in males [1]. Non-infectious aor-titis may be due to Takayasu’s...
- 4
- 353
- 0
Báo cáo y học: "Papillary fibroelastoma of the aortic valve - a case report and literature review" pptx
... papillary fibroelastoma of the aortic valve in a youngwoman -a case report. Cardiovascular Ultrasound 2009, 7:43.9. Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report of a surgical case ... twocases and review of the literature. Annals of Clinical & Laboratory Science2001, 31(3):29 1-2 96.8. Parthenakis F, Nyktari E, Patrianakos A, Pitsis A, Asimaki A, Vardas P:Asymptomatic papillary ... fibroelastoma of aortic valve: a case report and literature review. Angiology 2008,59(5):62 5-6 28.12. Ngaage DL, Mullany CJ, Daly RC, Dearani JA, Edwards WD, Tazelaar HD,Mcgregor CGA, et al: Surgical...
- 5
- 631
- 0
Báo cáo y học: " Beta-2-transferrin to detect cerebrospinal fluid pleural effusion: a case report" pptx
... effusion and a shunt series demonstrated an appropriately placed distal catheter tip. A subsequent abdominal ultrasound revealed marked ascites. Fluid drained via tube thoracostomy wassent for beta-2-transferrin ... Firstly, they propose that an error insurgical shunt placement, with resultant intrathoracictrauma, may account for some cases of CSF hydrothorax.Secondly, Taub and Lavyne suggest that pleural ... patient wasnoted to have an increasing abdominal girth, sizeablepositive fluid balance and weight gain. An abdominal/pelvic ultrasound revealed marked ascites. Structurallynormal major abdominal...
- 5
- 374
- 0
Báo cáo y học: " Pulmonary fibrosis secondary to siderosis causing symptomatic respiratory disease: a case report" pptx
... with symptomatic respiratory disease, most likely secondary to associated fibrosis. Case presentation: A 66-year-old Caucasian man was referred to the outpatient clinic with a 2-year history of ... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Pulmonary fibrosis secondary to siderosis causing symptomatic respiratory disease: ... symptomatic respiratory disease, mostlikely secondary to associated fibrosis. Case presentation A 66-year-old Caucasian man was referred to the outpa-tient clinic with a 2-year history of exertional...
- 3
- 426
- 0
Báo cáo y học: "In vivo approaches to investigate ANCA-associated vasculitis: lessons and limitations" pps
... proinfl ammatory properties promoting neutrophil and monocyte recruit ment and stimulation of release of proinfl ammatory cytokines such as TNF and IL-1 by macrophages. Interestingly, increased ... In vivo approaches to investigate ANCA-associated vasculitis: lessons and limitations. Arthritis Research & Therapy 2011, 13:204.Heeringa and Little Arthritis Research & Therapy 2011, ... recently by van Timmeren and colleagues [38], who focused on the autoantibodies themselves. In this study, the bacterial enzyme endo-glycosidase S (EndoS) was used to specifi cally hydrolyze the...
- 10
- 243
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... CentralPage 1 of 5(page number not for citation purposes)Clinical and Molecular AllergyOpen AccessResearchAsthma is a risk factor for acute chest syndrome and cerebral vascular accidents in ... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10]. Our findings of increased cerebral vascular accidents in patients with sickle cell ... retrospective chart analysis was performed investigating 48 children ages 3–18 years with asthma and sickle cell disease and 48 children with sickle cell disease alone. Children were matched for age, gender,...
- 5
- 288
- 0
Báo cáo y học: " Bringing metabolic networks to life: integration of kinetic, metabolic, and proteomic data" pptx
... 1 of 11(page number not for citation purposes)Theoretical Biology and Medical ModellingOpen AccessResearch Bringing metabolic networks to life: integration of kinetic, metabolic, and proteomic ... kinetic, thermodynamic, metabolic, and proteomic data.The structure of the metabolic system (i.e., stoichiometries and enzyme regulation) needs to be known, and the reactions are modelled by convenience ... ()()11111()yyR y () () ( ). + ()12R y Rmi y () ()()()() (*())2111111=+()ì++ CRCRRCyy Cyy y T y T y −−−−−−()=+()()112111113()T y θθθθ()()...
- 11
- 418
- 0
Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot
... withoutany valuable role for the organism [14]. Therefore, organis-mal complexity cannot be simply determined by the genomesize, the number of protein-coding genes, the number of introns, or the ... fromdozens of eukaryotic and hundreds of prokaryotic species.This has only brought us to the embryonic stage of genomebiology theory and numerous surprises are to be expectedalong the road ahead.References1. ... differentspecies is only the first step in understanding their intricateevolution in animals and other eukaryotic taxa. Biologistshave recently gained access to genomic information fromdozens of eukaryotic...
- 2
- 384
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật