Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai
M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi
H, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Research and Therapy
Open Access
Research
Two specific drugs, BMS-345541 and purvalanol A induce apoptosis
of HTLV-1 infected cells through inhibition of the NF...
Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc
... and differential, normal renal function
and normal hepatic function. She was admitted on day 6
of the cycle with febrile neutropenia, grade 2 mucositis
and grade 2 arthralgia and myalgia. Apart ... her
oesophagogastroduodenoscopy (OGD) and flexible sig-
moidoscopy revealed widespread ulceration in the eso-
phagus and gastric antrum that was biopsied. Meanwhile,
a galacto...
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
...
ACC: American College of Cardiology; AHA:
American Heart Association; CABG: coronary artery
binding graft; CK: creatine kinase; MACE: major ad-
verse cardiac events; MI: myocardial infarction; ...
results of these initial trials indicate that the ZES is
safe and reduces the rates of clinical and angiographic
restenosis in patients with symptomatic coronary ar-
tery disease...
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... important given
the frequency of femoral and acetabular defects asso-
ciated with THA infections
[7-9].
The aim of a two-stage revision is to eradicate
any residual bacteria after removal of the ... use of PROSTALAC
for the 2-stage revision of infected THA. The cement
of the femoral head
articulated with the bone of the
acetabular bed causing bone er...
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt
... (asynchr.)
was also analyzed. The percentage of cells in the G0/G1, S, and G2/M
phases of the cell cycle at each time point was determined by FACS
analysis and is shown at the bottom.
Fig. 4. Translation of ... 5¢-GGGAATTCTCAGATAGAGTCTTCTCTGG
GAGC-3¢
SG50: 5¢-GGGGACCAGGGTGACCGCGG-3¢
SG92: 5¢-GCGCGGGAGATCTAACGGACGG-3¢
SG108: 5¢-CCTCTAGACGCGCCGTCCGGTGCTGAC
TCAT-3¢
SG109:...
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx
... insertion of a selenocysteine in mammal
GPXs. The selenocysteine residue is important for the
catalytic activity of GPX as replacement of selenocysteine by
cysteine greatly reduces the activity of the ... variations
in the tissue and the subcellular concentrations of substrates
and reducing substrates, dual catalytic activities for a given
enzyme might constitute...
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGG
GTCG
ACTCAGTGATGGTGGTGATGGTGTCCTCGACC
AAAAAGATC; rcpA:forward,GCGATA
GAATTCATG
AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT
GTCGACTCAGTGATGGTGGTGATGGTGCTCCG
ACGGCAATGTCG; cphB:forward,GCGATA
GAATTC
ATG ... phytochrome-like
proteins of cyanobacteria (Calothrix sp. CphA
and -B, Synechocystis sp. Cph1, and Anabaena
sp. AphA and AphB, GenBank numbers
AB028873 and AB034952), Arabido...
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx
... several stabilizing
van der Waals’ contacts between the O4¢ atoms of the DNA
sugars and distamycin atoms are observed.
Rings A and B make an angle of 8.6 °,ringsBandC
21.1 °, and ring C makes an angle ... chemical calculations in
further analysis of crystallographic results, a combination
Table 3. Close contacts of atoms in the minor groove of d(GGCCAATTGG) or d(CGCA...
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... Example of calculation of the index of the quantity of allergen -specific Th cells and the number of precursor cells of
acquired allergen -specific cells (needed to calculate the absolute count of ... allergen -specific Th
or B cells was based on the ability of the cells to prolif-
erate. We assumed that all allergen -specific cells prolif-
erated...
Báo cáo y học: "Cartilage-specific autoimmunity in animal models and clinical aspects in patients – focus on relapsing polychondritis" ppsx
... half of the RP
patients the cartilage of the tracheolaryngeal tract is
affected. This is a potentially fatal symptom caused by a
collapse of tracheal rings and bronchi and/ or by inflamma-
tory ... RP and also indi-
cates that shared pathogenic pathways might be used in
RP and RA. As large variations in the severity and targets
of the inflammatory attack appear...
Từ khóa:
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Chuong 2 nhận dạng rui ro
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật