Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx
... Spier4AbstractInhaled corticosteroids (ICSs) are the most effective anti-inflammatory agents available for the treatment of asthmaand represent the mainstay of therapy for most patients with the ... significant improvements in the diagnosisand management of asthma over the past decade, as wellas the availability of comprehensive and widely-acceptednational and international clinical practice ... best availableliterature and expert opinion.PreventionAlthough ICS therapy represents the mainstay of asthmamanagement, physicians and other healthcare profes-sionals need to be aware o f the...
- 12
- 774
- 0
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx
... one can study the electricaland metabolic activity of the outer layers of the retina.During the adaptation of the retina to dark, the amplitude of the EOG gradually decreases, reaching a nadir ... Fotiou2, Apostolos Iacovides1 and George Kaprinis1Address: 1Laboratory of Psychophysiology, 3rd Department of Psychiatry, Aristotle University of Thesssaloniki, Greece and 2Laboratory of Clinical ... provide empirical data in order to assist in the understanding of the international literature and to explain the mechanism of action of therapieslike sleep deprivation and light therapy.BackgroundDepression,...
- 10
- 484
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... (pro)inflammatory mediators suchas cytokines and matrix metalloproteinases [3]. Increasedexpression of inflammatory chemokines has been found in many inflammatory disorders, including hepatic ... chemokines play a role in inflammatory conditions byinducing integrin activation, chemotaxis, and angiogenesis.Apart from modulating migration directly, chemokines canstimulate cells to release ... thesemolecules in normal homeostasis.ReviewChemokine blockade: a new era in the treatment of rheumatoidarthritis?Jasper J Haringman and Paul P TakDivision of Clinical Immunology and Rheumatology, Academic...
- 5
- 460
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... primer: ATGGTGAATATCATCATGAAAAAGATTCProbe: CATGCTCATTCTCAACCACATCACCAACAH6PDH Forward primer: CAGGTGTCCTAGTGCACATTGACReverse primer: GTAGCCCACTCTCTCGTCCAAProbe: AAGGCACGCCCTCCCAGCGGRα Forward ... GCGATGGTCTCAGAAACCAAACReverse primer: GAGATTACAGAGGAAGTTATCCTCTGCProbe: TGCAGTGAAGGTTGCTGAGGCTCTGAGRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CTReverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA ... treatment of inflammation.ConclusionStromal cells play a pivotal role in normal, physiological inflam-mation and persistent inflammatory disease by expressing fac-tors such as cytokines and...
- 10
- 438
- 0
Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx
... 5(4):557-572.42. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, andamplifications of genomic materials in primary ... relational database to storeits source data. In particular, two different kinds of dataare stored in two separate databases: genome annotationdata (as available in the Ensembl database [37]) and ... array CGH tiling microarrays or SNPmicroarrays. Although a number of software tools forarray CGH analysis and visualization are available —both from academia and commercial vendors — theyare...
- 12
- 455
- 0
Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot
... features of earlymalignant melanoma on glabrous skin. A videomicroscopicanalysis. Arch Dermatol 1998, 134:563-568.46. Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S,Yoshikawa ... detection of plantar malignantmelanoma. J Am Acad Dermatol 1990, 23:37-40.44. Miyazaki A, Saida T, Koga H, Oguchi S, Suzuki T, T T: Anatomicaland histopathological correlates of the dermoscopic pat-terns ... S,Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of dermoscopic patterns in detecting malignant melanoma onacral volar skin: results of a multicenter study in Japan. ArchDermatol 2004,...
- 6
- 413
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... groupdelay not only in the passband but also in the transitionband. The mean value of the group delay ranges below that of linear-phase filters of the same length. The observed overallsignal delay ... no tolerance10 EURASIP Journal on Advances in Signal Processingand secondly using the fact that in case of real-valued signals the real part in frequency domain corresponds to the evenpart in ... evident as seen in (40) that by minimizing the objective function the area bounded by the group delay in the passband is minimized. Minimizing the area results in minimizing the group delay itself in...
- 13
- 623
- 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx
... they are very useful in the study of scattering the- ory and their power comes from the fact that they arerepresentation independent; one may work either in the realspaceorintheFourierdualandcanmovefromonerepresentation ... easy task.However, there is a clever way to extract information fromthis matrix without going into involved mathematical anal-ysis. The idea is to optimize the above scattering equationusing ... Introduction to the Mathematical Theory of In- verse Problems, Springer, New York, NY, USA, 1996.[20] V. Raghavan and A. M. Sayeed, “MIMO capacity scaling andsaturation in correlated environments,” in...
- 10
- 548
- 0
Báo cáo y học: " Rectal microbicides: clinically relevant approach to the design of rectal specific placebo formulations." ppsx
... design, data analysis and drafting of the manuscript. All authors read and approved the final draft.Competing interests The authors declare that they have no competing interests.Received: 6 October ... evaluated using the MTT [1-(4,5-dimethylthiazol-2-yl)-3,5-diphenylfor-mazan] assay and histology.Rabbit Rectal Irritation Study A ten day repeat dose toxicology study in New Zealandwhite rabbits ... were maintained with the luminal surface at the air-liquid interface with the lamina propria resting on medium-soaked gelfoam. Cul-tures were maintained at 37°C in a 5% CO2atmosphere.Placebo...
- 10
- 731
- 0
Báo cáo y học: "NPAS2 and PER2 are linked to risk factors of the metabolic syndrome" pps
... taken and adapted from the Seasonal Pattern Assess-ment Questionnaire (SPAQ) [23]. The questionnaire wastranslated into Finnish and then back-translated to revise the linguistic accuracy. Each of ... gave a rationale for the current study.MethodsThis study was part of a nationwide health interview andexamination survey, the Health 2000 Study, which wascarried out in Finland, a north-eastern ... Finnishwas made pair wise by psychiatric professionals andrevised by others. The official Finnish translation of the DSM-IV classification was used as a basis for formulating the interview. The...
- 9
- 482
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam