Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... p300,to primary response genes to maintain an active chromatin acetylation signature. Inducible transcription factors thenrecruit different acetylases that modify a different set of lysines on the ... respec-tively, were acetylated in the unstimulated cells, only 3% (two genes) of the promoters of primary response genes becametransiently acetylated at 0.5 h following activation and 5% (14 genes) of the ... keep-ing with the delayed expression of these genes (Figure 6b;Additional data file 3). The inability to detect Pol II on somesecondary response genes may relate to the affinity of the antibody coupled...
- 18
- 641
- 0
Báo cáo y học: "Immunocytokines: the long awaited therapeutic magic bullet in rheumatoid arthritis" ppsx
... proteindirected against an irrelevant protein antigen.Concomitant neutralization of signaling?Unfortunately, they did not include in their studies the therapeutic impact of the targeting antibody ... [1]showed that cytokines can be targeted to the site of interestby using scFv antibody fragments recognizing extracellularmatrix (ECM) components present in the joint. The firstquestion they addressed ... functions of both the antibody and the cytokine. In cancer, the use of single-chain antibodyfragments for targeting and in vivo imaging of tumors is a newweapon in the oncologist’s armamentarium...
- 2
- 272
- 0
Báo cáo y học: " Microarray-based genomic surveying of gene polymorphisms in Chlamydia trachomatis" ppsx
... B/TW-5 indicated that these genes are absent orotherwise highly divergent (Table 1). As this region was nothighly ranked in any of the other strains, the results indicatedthat the trp operon ... they are present in the test- or in the reference-strain gene. An insertion in a test-strain gene willcause the region to be longer than the complementarysequence on the array, forcing the test ... present in the remainder of the strains. The CT868 gene region of strain L1/440 was interest-ing because of the fact that its high signal ratio and high rankwere not entirely due to nucleotide...
- 9
- 545
- 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf
... hormone[38,40]. The changes engineered in the sequence of the peptide, either through the nature of the side chain of the new amino acids or through their non-native conforma-tional features, increase the ... Analysis of the distribution of the electrostatic potential on the surface of the moleculereveals the ampiphilic character of the helix (Fig. 4A).Schematic representation of the charge distribution ... Aib15]CRH, contain upto 84% helical structure. This value is either somewhatlarger than that of the 76–78% regarding the helicity of the native peptide in solution containing 66–100% of TFE[15,40],...
- 11
- 515
- 0
Báo cáo Y học: Reconstructing the replication complex of AcMNPV pdf
... CCGCCCGGGTTATTTTTTCA GGCCCGGGCTCGAGTTTTTTTTTTATAC CATTTTATACIE1 5¢ CTATGACGCAAATTAATTTT GGCCCGGGAATTCACGCAAAAACGC TTAATTTTAACGCIE1 3¢ CCGCCCGGGTTATCGCCAAC GGCCCGGGCTCGAGTCGCCTCCCATTGTTAAT AACTCCCATTGTTAATIE2 ... CATCACGATCTATGTTAGT GGCCCGGGAATTCATGTTAGGTGCAATTATAC TGTGCAATTATACLEF-1 3¢ CCGCCCGGGTTATGTGGTAC GGCCCGGGAGCTCTTATGTGTTTTTG GTACTTTTTGLEF-2 5¢ CATCACAGATCTATGGCGA GGCCCGGGAGCTCTATGGCATGCATCG GAATGCATCGLEF-2 ... CATCACAGATCTATGTCGAG GGCCCGGGCTCGAGATGTCCGTTACAAAGCG GAGCGTTACAAAGCGLEF-7 3¢ CCGCCCGGGTTATTCTTTCA GGCCCGGGCTCGAGTTCTTTCAATTCTG CACAATTCTGHEL 5¢ CATCACAGATCTATGATTGA GGCCCGGGGAATTCATGATTCAACATTTTAC...
- 8
- 443
- 0
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt
... be transported easily in the cytoplasm. Fourth, theyshould enter the nucleus easily. For transfection in vivo,thisis one of the most important hurdles. Finally, cytotoxity isanother major ... covalently lactosylated,forming a lactose–PEI complex. The complex carryingRDO was administrated by tail vein injection into rats eitheronce or repeatedly at fixed intervals. The results showed thatRDO ... reported to correct point mutations in mitochondria isolated from hepatocytes, indicating thatmitochondria have the machinery required for the repair of single-point mutations [45]. In order to...
- 6
- 425
- 0
Báo cáo khao học: "Defining the transition from earlywood to latewood in black spruce based on intra-ring wood density profiles from X-ray densitometry" pot
... used to describe the intra-ring wood density profile, 4th to 6th order polynomial weretested. The E/L transition was defined as the inflexion point. The latteris obtained by equalling the second ... derivative of the spline function. Theoretically, the maxi-mum represents an inflexion point in the intra-ring wood den-sity profile and could be determined mathematically.Another study [18] ... early-wood-latewood transition point. They used a modified splinefunction technique to smooth the intra-ring wood density pro-files. The E/L transition point was defined as the maximum of the derivative...
- 8
- 252
- 0
Báo cáo y học: "To the Editor: We have diagnosed a patient from Quebec" ppsx
... CD154deficienc y: normal growth, the presence of lym-phadenopath y , infections only of bacterial origin,and the lack of cytopenias. Our patient’s AIDmutation proved to be identical to that found ... patient’s mutationproved to be identical to that of all other FrenchCanadians with AID defects. This case illustrates the clinical nature of AID deficiency, and review of the relevant literature sheds ... resulting in cys-teine replacing arginine at position 112 of the pro-tein. In ever y French-Canadian patient with AIDdeficienc y (there have been 15 such patients if ourpatient is included)...
- 2
- 325
- 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... andsimvastatin are semi-synthetic derivatives, whereasfluvastatin, atorvastatin and rosuvastatin are entirelysynthetic [1]. Lovastatin and simvastatin are of the lactoneReviewDo the pleiotropic ... therapy haseven short-term benefits when administered in the setting of the acute coronary syndrome in patients with normalcholesterol levels. The MIRACL study demonstrated thatatorvastatin in this ... some of which mighthave immune-modulatory potential. Five statins arecurrently available within the UK: pravastatin, simvastatin,fluvastatin, atorvastatin and rosuvastatin; in addition,lovastatin...
- 7
- 334
- 0
Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx
... duplications. The origin of the Metazoa is a landmark event in the history of life and we are now taking critical steps in the under-standing of this major transition. The oomycetes are another group ... being detected in the greatest numbers.Protist genomes and metagenomesSeveral presentations sought to further our understanding of a major transition in evolutionary history - the origin of ... work that is complementary to the projects in UNICORN, showing how the systematic comparative analysis of core and accessory genes of chytrids can shed light on the origin of complex eukaryotic...
- 3
- 279
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendefining the legal status of outer space in the period 1958 1966insight into the molecular mechanism of translesion dnasynthesis in human cells using probes with chemically defined dna lesionsthe potential use of triterpene compounds in dendritic cells based immunotherapybáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ