Báo cáo khoa hoc:"Food resource allocation patterns in lactating females in a long-term selection experiment for litter size in mice" pot
Báo cáo khoa hoc:"Food resource allocation patterns in lactating females in a long-term selection experiment for litter size in mice" pot
... non-reproductive and lactating animals as a source of variation in RFI. Indeed, the maternal body has to adapt greatly to the process of lactation.Apart from an increase in mammary size, lactating mice and ... 10.1051/gse:2001005Original articleFood resource allocation patterns in lactating females in a long-term selection experiment for litter size in miceWendy M. RAUW a, ∗, Pieter W. KNAPb,Martinus W .A. VERSTEGENc, ... S-line females had a significantly higher food intake than C-line females. Sns -females had higher food intake than Ss -females (P < 0.05).After weaning there was a decreasing trend in food intake,...
- 22
- 206
- 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot
... VAC materials available regionally and internationally; construction of questionnaire and interviewing of existing farming communities who are participating in the traditional VAC systems, selection ... appropriate improved VAC guidelines and manuals for household aquaculture in the North Central of Vietnam. iii) To build capacity for improved VAC application among stakeholders involving in aquaculture ... Environment and Disease Monitoring in Aquaculture (CEDMA) Vietnamese Project Team Leader Mr. Mai Van Tai (Project director) Mr. Mai Van Ha (Project manager) Australian Organisation Muresk Institute...
- 7
- 351
- 1
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx
... modified VAC farming operations. 7. Provide technical training in Australia for two Vietnamese scientists (planed in October or November, 2009) 8. Finalisation of the final MAS internal reporting ... Building A capacity building initiative has commenced at CEDMA. The transfer of technology in the area of water RAS, nutrient recycling across various farming components of VAC practices and ... horticulture and animal husbandry practices) and identify incentives and constraints for improved VAC application ii) To develop appropriate improved VAC guidelines and manuals for household aquaculture...
- 8
- 416
- 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx
... Quang Xuong, Thanh Hoa Snake-head in tanks and cages Mr. Hieu Quang Giao, Quang Xuong, Thanh Hoa Snake-head in tanks and cages Mr. Nam Quang Giao, Quang Xuong, Thanh Hoa Snake-head in ... (each province has 1 visit, especially Quang Tri had 2 visit) • 16 participants in Hue, 60 participants in Quang Tri, 16 participants in Ha Tinh, 30 participants in Nghe An, and 85 participants ... Email: r.fotedar@curtin.edu.au In Australia: Administrative contact Name: As mentioned above Telephone: Position: Fax: Organisation Email: In Vietnam Name: Mr Vo Van Binh...
- 13
- 343
- 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt
... but are of an area less than 200m2 particularly in areas of limited access to water, • Availability of raw materials (eg manures from cattle and/or poultry in the area), • Suitable for culture ... temperature decreases in winter, grass or banana leaves can be applied to cover the surface to maintain temperature and prevent mass mortality. Light can be applied to increase temperature. ... after stocking was a result of transportation and poor fingerling quality. 4. Lessons learned for adjustment in design and operation of VAC models in Year 2 • If farmers are not financially...
- 15
- 412
- 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt
... be achieved. In making such decisions, markets and skills available were also considered. An example of such a situation is a farm in Ha Tinh where the water surface area was greater than three ... Hue, 3 in Quang Binh, 4 in Ha Tinh, 1 in Nghe An, and 4 in Thanh Hoa). See Appendix 1 for the final economic analysis summary. Six high value aquatic species were introduced into integrated ... VAC practices; • Drafting of action plans for VAC demonstration systems which including farming of high-value species in an environmentally sustainable manner. Additional demonstration farms...
- 9
- 480
- 0
Báo cáo khoa học: Mitochondria regulate platelet metamorphosis induced by opsonized zymosan A – activation and long-term commitment to cell death potx
... Coutinho PM & Henrissat B (1999) Carbohydrate-active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering (Gil-bert HJ, Davies B, Henrissat B & ... the general acidresidues in the entire superfamily (Table 2).Chitosanase as a resistance determinant againstantimicrobial action of chitosanThe finding that a heterologous chitosanase can protectE. ... Blanchard J, Park JK, Boucher I & Brzezinski R (2003)Industrial applications of chitosanases. In RecentAdvances in Marine Biotechnology, Biomaterials and Bio-processing (Fingerman M &...
- 13
- 382
- 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx
... Alternaria alternata 102 was kindly provided byK Takatori (National Institute of Health Sciences, Tokyo,Japan). A. alternata 102 maintained on a PDA slant(potato dextrose agar; Franklin Lakes, ... (F)TCGCCTTGTGGAAGTTTGAGAC (R)AACATTGTCACCAGGGAGTGCC 665 56acidic PR-3 M29868 (F)CAGGAGGGTATTGCTTTGTTAGGC (R)ATCTTCCACTGCGTCATTCCGTCC 356 58basic PR-3 X16938 (F)GCCATAGGAGTGGACCTGCTAAAC (R)AAAAGACCTCTGGTTGCCGC ... AaGlucan triggered a similar level of chitinaseactivity. However, laminarin was applied at a concen-tration that was 1000 times that of the AaGlucan, indi-cating that the AaGlucan has a much...
- 11
- 358
- 0
Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx
... method to form a complex between TVA II and a pullulanmodel substrate by using partial hydrolyates of pullulan andan inactive TVA II mutant, D325N. A hexasaccharidecontaining two panose units, ... primer: 5¢-GATCACACTCTCGCGAAACAAATAATTCATCACCG-3¢. The underlined nucleotide in the primer indicates the mismatched nucleotide creating thealanine substitution mutation. DNA sequencing confirmedthe ... Yanase, M., Takata, H., Shimada, J.,Handa, S., Takada, T., Umeyama, H. & Okada, S. (1996) Con-trolling substrate preference and transglycosylation activity ofneopullulanase by manipulating steric...
- 9
- 361
- 0
Báo cáo khoa học nông nghiệp " Commercial and High Quality Cultivars of Root and Tuber Crops for Processing Purpose in the Northern and Central Vietnam " potx
... production and suggestion Data in Table 2 show that in Thanhhoa and Bacgiang province sweet potato was mainly cultivated in the winter season. However, in Quangtri province, sweet potato was largely ... Quangtri, mainly as a winter crop in Thanhhoa and as a winter and spring crop in Bacgiang. • Farmers in all investigated localities needed new, high yielding varieties with good quality, and an accompanying ... and spring crops. In Quangtri province, sweet potato was mainly cultivated as the winter-spring crop. On the other hand, in Thanhhoa and Bacgiang provinces, sweet potato was largely cultivated...
- 27
- 395
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ