Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

... preferential treatment, E(Di!), increased with or2 h, as illustrated intable I.Original article Attenuating effects of preferential treatment with Student-t mixed linear models: a ... clearly inappropriate. It appears that some robust linear models can handle preferential treatment of animals better than the standard mixed effect linear model with Gaussian ... the values of Qh and A as shown in the Appendix. The averageamount of preferential treatment actually applied was assessed via a simula-tion of 1000 replicates of the...

Báo cáo khoa học: "The effects of cyclophosphamide treatment on the pathogenesis of subgroup J avian leukosis virus (ALV-J) infection in broiler chickens with Marek''''s disease virus exposure" potx

... curve analysis was done with an initial denaturation at 95oC. DNA melting wasaccomplished with an initial temperature of 65oC for 10seconds and a gradual temperature increase with a transitionrate ... were analyzed using Kruskal-Wallis analysis of variance. Significance was assumed at the0.05 level of probability.ResultsBody weight, relative bursal weight and lymphocytemitogenesis assayThe ... Currentstatus of diagnosis, epidemiology and control of ALV-J. In:Proceedings of the avain tumour viruses symposium, pp. 58-62. Reno, Nevada: American Association of AvianPathologists. 1997.23. Payne...

báo cáo khoa học: " Molecular imaging of potential bone metastasis from differentiated thyroid cancer: a case report" docx

... exclude a metabolically activespinal metastasis.Case reportWe present the case of a 50-year-old Caucasian woman with a vertebral metastasis of a less well differentiatedthyroid cancer, who was ... An MRI scan revealed a ver-tebral metastasis at the T11 level with intraspinal exten-sion compressing the spinal cord. Our patient wasoperated on via a bilateral posterolateral approach,allowing ... Hospital of St. Louis, University of Paris, Paris, France.5Department of Neurology,University of Addis Ababa, Addis Ababa, Ethiopia.Authors’ contributionsNS, GP, MO and BS analyzed and interpreted...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... inenzymes: a study of triosephosphate isomerase andcomparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... The inﬂammation is also accompanied bythe release of large amounts of ATP from stimulatedcells [13,25]. A large body of evidence indicates thatcationic antimicrobial peptides create channels ... 253–257.34 Takeshima K, Chikushi A, Lee KK, Yonehara S &Matsuzaki K (2003) Translocation of analogues of theantimicrobial peptides magainin and buforinacross human cell membranes. J Biol ... characterization of histogranin, a natural peptide with N-methyl-D-aspartate antagonist activity. Eur J Pharmacol MolPharmacol 245, 247–256.15 Lemaire S, Rogers C, Dumont M, Shukla VK, LapierreC,...

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... from an alternativeinitiation of translation with an inframe ATG located 78 bp down-stream of the ﬁrst ATG. (B) Graphic representation of the resultsobtained in the REF assay expressed as percentage ... REF assay, subcellular localization, and transcrip-tional activity. Some of these analyses have assigneddifferential functions to the two isoforms, and we showthat the unique amino terminal ... luciferasevalues were normalized to protein concentration as assessedby a Bradford assay.Protein preparation and western blotting analysisProtein preparation and western blotting analysis...

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... S inica, Taipei, TaiwanVolvatoxin A (VVA) has been isolated from Volvari-ella volvacea, and consists of volvatoxin A2 (VVA2)and volvatoxin A1 (VVA1) [1]. VVA has several biolo-gical activities, ... of volvatoxin A2 (VVA2) to volvatoxin A1 (VVA1) was inhibited by the amphipathic a- helices of VVA1. The VVA2 and VVA1 mixture (molar ratio 2) was incubated with VVA1 beads;the interaction was ... FEBSvia SDS ⁄ PAGE analysis (Fig. 4A, lane 2). Interest-ingly, again no oligomers of VVA2 were detected afterincubation of VVA2 with VVA1 at a molar ratio of 2(Fig. 4A, lane 2).When VVA1 beads...

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... (5¢-TAGTTCCCCGGGGGTGAAGCTGAAGTTTCTCTGACCGGTCAGCCGTTC-3¢) and reverseprimer tsf-DOWNS (5¢-AGTCAGGATCCGTCGACAGAGCTTCGCCACTCAACTTAAGCAGAA-3¢). Likeprimer Ts185, Ts224 contains a unique AvaI restriction site(underlined) and part of a sequence ... ensure a satisfactory frequency of homologous recombination for the gene replacement. Theupstream fragment was prepared using forward primer tsf-UPS (5¢-ATGCGGGATCCAAGCTTGAGCTTACATCAGTAAGTGACCGGGATGA-3¢) ... was inserted as alinker (Figs 1 and 2).Chromosomal DNA from E. coli strain UY211 (ara,D(lac-pro), nalA, thi) [32] was isolated and used as a templatein two separate PCR reactions to prepare...

Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

... werecombined with Filtron-X scintillant (National D iagnostics,Atlanta, GA, USA) and radioactivity was measured using a beta counter (2200CA Tri-carb Liquid Scintillation Ana-lyser; Canberra Packard, ... equipped with argon, krypton, and ultraviolet lasers.Confocal images w ere acquired at ·40 magniﬁcation usingTCS NTsoftware (Leica Microsystems).Statistical analysisStatistical a nalysis was perf ... was digested at the SmaIsite, upstream of t he minimal promoter, and double-stranded oligonucleotides (sense strand: 5¢-GCTGTACAGGATGTTCTAG-3¢ and 5¢-GCTGTACAGGATGTTCTAGGCTGTACAGGATGTTCTAG-3¢),...

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... ATGGCCAAAATCACAAGGGTTAGCABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATCABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACATABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGGABCC11 ... the ABC transporters for quantitative real-time RT-PCR.ABC transporter Position of primer Forward oligo sequence Reverse oligo sequenceABCB1 834–1086 GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGCABCC1 ... 3025–3560 CCACGGCCCTGCACAACAAG GGAATTGCCAAAAGCCACGAACA100000100001000100101MRP1-HEK293 MRP4-HEK293 MRP5-HEK293% Expression of ABC Transporters Comparedto parental HEK293 cellsABCB1ABCC1ABCC4ABCC5ABCC11Fig....

Xem thêm