Báo cáo y học: "Rheumatoid cachexia is associated with dysli

Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf

... statistical analysis. Results Dietary intake and fatty acid profiles The mean dietary intake of total energy, carbohydrate, protein and fat is shown in Table 2. Compared with the Swedish Food Recommendations ... energy percentage; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid. Available online http://arthritis-r...

Ngày tải lên : 09/08/2014, 13:22

11
549
0

Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx

... care by impacting a bility to take antiretroviral medications in a number of ways, including causing symptoms of nausea while taking medications on an empty stomach, increasing drug toxicity, ... I, et al: Adherence to antiretroviral therapy in Sub-Saharan Africa and North America: a meta-analysis. JAMA 2006, 296(6):679-90. 37. Bassett I, Wang B, Chetty S, et al: Loss to car...

Ngày tải lên : 10/08/2014, 05:21

8
438
0

Báo cáo y học: "Preoperative statin is associated with decreased operative mortality in high risk coronary artery bypass patients" pot

... osis of coronary artery disease and the statin is not always started before operation, especially in the urgent or Table 2 Study Population and results of bnivariate analysis of statin groups All ... study design, manuscript preparation, and presentation at national meeting. DAD assisted in study design and statistical analysis. KAS developed the database and performed...

Ngày tải lên : 10/08/2014, 10:20

5
399
0

Báo cáo y học: "Rheumatoid arthritis is an independent risk factor for multi-vessel coronary artery disease: a case control study" pdf

... groups. Characteristics of cases with RA and CAD Table 1 includes characteristics of the patients with RA. Aver- age age at onset of RA was 55 years and the average disease Available online http://arthritis-research.com/content/7/5/R984 R990 without ... contributes to accelerated CAD. The inflammatory mechanisms in RA may enhance atherogen- esis in several ways. C-reactive...

Ngày tải lên : 09/08/2014, 06:23

8
401
0

Báo cáo y học: "Rheumatoid cachexia: a complication of rheumatoid arthritis moves into the 21st century" potx

... joint inflammation improves. Rheumatoid cachexia may be an important risk factor for cardiovascular disease and excess mortality in RA. In this issue of Arthritis Research & Therapy, Elkan and ... in fact, loss of body fat- free mass is often accompanied by increased fat mass and stable body weight. Rheumatoid cachexia may affect up to two-thirds of all pat...

Ngày tải lên : 09/08/2014, 14:20

2
257
0

Báo cáo y học: "Serum cholesterol concentration associated with aspirin esterase activity in older people: preliminary data"

... circulation where two distinct aspirin hydrolysis pathways act: a spontaneous pH-dependent hydrolysis and an en- zymatic hydrolysis by plasma/serum and erythrocyte esterases (6). The circulating ... aspirin hydrolysis occurs in blood, there is a paucity of information in regards to circulating aspirin esterase activity in various physiological and pathological conditio...

Ngày tải lên : 26/10/2012, 09:39

4
609
1

báo cáo hóa học: " Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: Evidence for an immune-modulated glutamatergic neurotransmission?" doc

... kynurenine pathway, indoleamine 2,3-dioxygenase (IDO), and the enzyme that catalyses the production of 3-OH-kynurenine, kynurenine monoxygenase (KMO), are activated by proinflammatory cytokines, including interleukin-1 ... Effects of ketamine on anterior cingulate glutamate metabolism in healthy humans: a 4-T proton MRS study. Am J Psychiatry 2005, 162:394-396. 30. APA: Diagnostic...

Ngày tải lên : 19/06/2014, 22:20

9
507
0

báo cáo hóa học:" Elevated osteoprotegerin is associated with abnormal ankle brachial indices in patients infected with HIV: a cross-sectional study" pptx

... DAA assisted in collecting data and creating the database, the interpretation of study findings, and the critical revision the manuscr ipt. MW assisted in data and statistical analysis, interpretation of ... is- tory of cardiovascular and cerebrovascular diseases was obtained by self-report and/ or cha rt review. History of cardiovascular disease, including documented h...

Ngày tải lên : 20/06/2014, 08:20

6
381
0

Báo cáo khoa học: "Advancing parity is associated with high milk production at the cost of body condition and increased periparturient disorders in dairy herds" pot

...

Ngày tải lên : 07/08/2014, 18:21

10
415
0

Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx

... GAPDH, forward: ACCCAGAAGACTGTGGATGG; GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, forward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse: GCTCACAAGAACAGACTTTCCAG; and RANKL, forward: CCAAGATCTCCAACATGACT; ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo- clastogenesis by ectodomain shedding of receptor activator...

Ngày tải lên : 09/08/2014, 10:22

9
410
0