Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTAT...
Ngày tải lên : 09/08/2014, 10:23
  • 8
  • 576
  • 0
Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt

Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt

... acquisition and analysis of the data. BK was involved in the development and adaptation of the ELISA method for SF and in the acquisi- tion of data. CAM was involved in data acquisition. EJMAT was involved ... design, analysis, interpretation, and writing of the data. BSF was involved in the acquisition, analysis and interpretation of the data and in draft- ing the manus...
Ngày tải lên : 09/08/2014, 08:22
  • 10
  • 406
  • 0
Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt

Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt

... suggest that binge eating symptomatology may play an important role in the initi- ation and maintenance of the WG phenomenon observed in at least part of patients with schizophrenia. Finally, management ... nervosa (BN). Psychiatric status was assessed through a chart review, medical doctor referee and psychiatrist interview. Data analyses Statistical analysis was performed by S...
Ngày tải lên : 08/08/2014, 21:20
  • 4
  • 331
  • 0
Báo cáo y học: "High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis" potx

Báo cáo y học: "High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis" potx

... OA synovial membranes was con- ducted by one of the investigators (PS), who has diag- nosed more than 2500 synovial tissue samples of RA. DNA microarray analysis A global expression analysis of ... unravel disease-specific differences that are character- istic for synovial tissue from patients with RA versus OA disease, total RNA from 30 mg synovial tissue was iso- lated...
Ngày tải lên : 09/08/2014, 01:23
  • 12
  • 402
  • 0
Báo cáo y học: "CXCR3/CXCL10 expression in the synovium of children with juvenile idiopathic arthritis" pot

Báo cáo y học: "CXCR3/CXCL10 expression in the synovium of children with juvenile idiopathic arthritis" pot

... by macrophages in synovial mem- brane of patients with JIA but not of controls. This finding suggests that CXCL10 is part of the matrix of cytokines that regulates the accessory activity of macrophages ... revised criteria for JIA according to the International League of Associations for Rheumatology (ILAR) classification [8] and were managed at the Pediatric Rheumat...
Ngày tải lên : 09/08/2014, 06:22
  • 9
  • 449
  • 0
Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."

Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."

... myolymphokinetic activities have been developed for the treatment of lymphedema. This novel approach can be adapted for the treatment of lymphedema in mass. Key words: lymphedema, filariasis, ... reporting recent advances and contributions. A new technique of manual lymph drainage, mechanisms of compression, development of active and passive exercising apparatuses and t...
Ngày tải lên : 26/10/2012, 09:39
  • 4
  • 646
  • 0
Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"

Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"

... can only be performed after an exact anatomical preparation and mobilisation of the tissue layers. This anatomical preparation and the resulted reconstruction of the soft-tissue layers may ... Postoperatively, all patients have been treated with systemic antibiosis according to antibiogram for the first 2 weeks followed by an oral antibiosis for another 2 weeks. In cases w...
Ngày tải lên : 26/10/2012, 09:53
  • 6
  • 575
  • 1
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"

... gentamicin and may therefore be more effec- tive in preventing biofilm formation than Palacos. When mixing the cement with antibiotics, it is important to leave as many large crystals intact as ... frequency of femoral and acetabular defects asso- ciated with THA infections [7-9]. The aim of a two-stage revision is to eradicate any residual bacteria after removal of...
Ngày tải lên : 26/10/2012, 09:53
  • 5
  • 549
  • 0
Báo cáo y học: "Progress and Challenges in the Understanding of Chronic Urticaria" pptx

Báo cáo y học: "Progress and Challenges in the Understanding of Chronic Urticaria" pptx

... distinguish patients with idiopathic urticaria from patients with autoimmune urticaria. A basophil abnormality is of particular interest because some patients with chronic urticaria have basopenia 31 and hyporesponsiveness ... TH1/TH2 cytokines and inflammatory cells in skin biopsy specimens from patients with chronic idiopathic urticaria: comparison with the all...
Ngày tải lên : 08/08/2014, 21:20
  • 5
  • 467
  • 1
Báo cáo y học: "Active DNA demethylation in human postmitotic cells correlates with activating histone modifications, but not transcription levels" ppt

Báo cáo y học: "Active DNA demethylation in human postmitotic cells correlates with activating histone modifications, but not transcription levels" ppt

... only actively demethylate cytosine residues, we Figure 3 Comparison of MCIp microarray and MassARRAY EpiTYPER data. (a- c) Diagrams at the top show signal ratios of microarray probes for both independent ... individual transfections was normal- ized against Renilla luciferase activity. Additional material Abbreviations AICDA: activation-induced cytidine deaminase; bp: base pair; ChIP:...
Ngày tải lên : 09/08/2014, 20:22
  • 11
  • 313
  • 0

Xem thêm

Từ khóa: