Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx
... to28 days (chronic phase of inflammation) after induction of AIA. The patella and the menisci of the joints with adjacent synovial tissue were separated and cultured in 24-well plates in DMEM(Gibco, ... 1:153-171.23. Dray A, Perkins M: Bradykinin and inflammatory pain. TrendsNeurosci 1993, 16:99-104.24. Heppelmann B, Pawlak M: Sensitisation of articular afferents in normal and inflamed knee joints by ... occurrence of joint pain.During inflammation in the joint, sensory fibres show changes in the expression of receptors that are important for the activation and sensitization of the neurones and the...
- 12
- 184
- 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... GTTTGAATTGGCCAGAGGAAreverse, TCTGTTGGAAAATCCCGTTCCxcl10 forward, CCCACGTGTTGAGATCATTGreverse, GAGGAACAGCAGAGAGCCTCCxcl10pre-mRNAforward, AGCAGAGGAAAATGCACCAGreverse, CACCTGGGTAAAGGGGAGTGADusp16 ... CCTAGCTTGGCTGACAGAGG;reverse, CTGCTCCTTCTCCTTCATGCAsns forward, TACAACCACAAGGCGCTACA;reverse, AAGGGCCTGACTCCATAGGTTrb3 forward, CAGGAAGAACCGTTGGAGTT;reverse, TTGCTCTCGTTCCAAAAGGAActb forward, AAGGAAGGCTGGAAAAGAGCreverse, ... AGGCCACTGACTAGGCTGAAEgr1pre-mRNAforward, GAGCAGGTCCAGGAACATTGreverse, GGGATAACTCGTCTCCACCANdrg1 forward, ACCTGCTACAACCCCCTCTTreverse, TGCCAATGACACTCTTGAGCIdi1 forward, GGGCTGACCAAGAAAAACreverse,...
- 12
- 560
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); ... was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); ... expression vector was obtained from pJH2-SSTR2 by homologousrecombination introducing the c-myc-OR17-40 codingsequence, using primers (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG...
- 14
- 473
- 0
Improving Maternal, Newborn, Child Health, and Family Planning Programs through the Application of Collaborative Improvement in Developing Countries: A Practical Orientation Guide pptx
... substantially in Afghanistan and Guatemala and the application of active management of third stage of labor (AMTSL) in several countries including Niger, Mali, Afghanistan, and Ecuador increased ... substantially. Essential Newborn Care: In Uganda, the ability of the health facility staff to detect neonatal asphyxia and immediately apply resuscitation increased dramatically. Infant and ... indicators developed in Kenya to measure achievement of an aim related to increasing antenatal care coverage. Usually, the same set of indicators is measured across all participating collaborative...
- 34
- 542
- 0
Báo cáo y học: "Treatment of hypertriglyceridemia and HIV: fenofibrate-induced changes in the expression of chemokine genes in circulating leukocytes" ppsx
... in circulating leukocytes. The data suggest that PPARα activators may be useful in the attempt to decrease the risk of atherosclerosis and may actas modulators of systemic inflammation and the ... manuscript. JJ, JC and JMA con-tributed to the final version of the manuscript. GA, RB-D and AR helped in the data analysis and interpretation. JJ and JC supervised the laboratory determinations. ... contributionsCA-V and JJ designed the study. CA-V, GA and RB-D ana-lyzed the data. GA, RB-D, LF-S and AR collected data orperformed various measurements for the study. CA-Vwrote the first draft of the...
- 4
- 375
- 0
Báo cáo y học: "Flow cytometric assessment of the signaling status of human B lymphocytes from normal and autoimmune individuals" doc
... intracellular flow cytometric analysis of signalingpathways, such as the NF-κB and MAPK cascades, can be used routinely to assess the activationstatus of a small number of cells and thus delineate abnormalities ... the number of samples is great, such as in a clinical trial.Advantages and disadvantages of multiparameterintracellular flow cytometric analysis of lymphocytesignaling statusMultiparameter intracellular ... National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland, USACorresponding author: Amrie...
- 11
- 479
- 0
Báo cáo y học: "Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus" ppsx
... and careful discus-sion of the data. CB coordinated the study, was involved in the critical discussion of results and their interpretation and helped to draft the article. All authors read and ... the synovial membrane and the formation of a pannus,which leads to swollen joints and finally to joint destruction.Inflammatory cells such as monocytes and neutrophils,together with T and B cells, ... patients with RANegative correlation in the frequency of CXCR3hi and CXCR5+ B cells in patients with RA. Correlation factor (Spearman's) and P value are indicated (GraphPad software).Figure...
- 13
- 504
- 0
Báo cáo y học: "Significance of differential expression of thymidylate synthase in normal and primary tumor tissues from patients with colorectal cancer" ppsx
... HenanProvincial Institute of Cancer, Zhengzhou, Henan Province, China.2Department of Pathology, Henan Provincial Cancer Hospital, HenanProvincial Institute of Cancer, Zhengzhou, Henan Province, ... RK,Williams NS, et al: Adjuvant chemotherapy versus observation in patientswith colorectal cancer: a randomised study. Lancet 2007, 370:2020-9.3. Shanmugam Chandrakumar, Hines Robert B, Jhala Nirag ... China.3Department of Surgery, Henan Provincial Cancer Hospital, Henan ProvincialInstitute of Cancer, Zhengzhou, Henan Province, China.Authors’ contributionsYL and SY designed the study, interpreted...
- 2
- 181
- 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... chromatin-bound proteins(Fig. 3 and Table 2). In contrast, the amounts of totalFig. 4. Abundance of Mcm2 mRNA in HeLa and WI-38 cells. (A) Total mRNA was purified from HeLa and WI-38 cells, and the ... fragment. These fragments areindicated. (B) Total RNA was purified from HeLa and WI-38 cells and analyzed by Northern blot analysis. Increasing volumes (0.7, 1.5 and 3 lLeach) of the total RNA ... deep invasion. To furthercharacterize the expression of Mcm4, PCNA and Ki67 in cancer cells, a section that contains a boundary region of CIS (CIN3 of FIGO classification) and dysplasia (CIN1)was...
- 13
- 486
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... would have to take into account the evolution of real wages as well as of wage arrears. However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased ... variables -the coordinates of each firm along axis f1 and f2- which are continuous and orthogonal, byconstruction, and incorporate a large fraction of the information present in the data set.Moreover, ... basis by the RussianAcademy of Science. Questions are mainly of a qualitative nature, with a number of possible answers ranging from two to ten, as their scope takes a more cardinal nature in...
- 30
- 635
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ