Báo cáo khoa học: "The script concordance test in radiation

Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx

... of data and interpretation of data and has been involved in drafting the manuscript. RG contributed to conception and design, analysis and interpretation of data and has been involved in revising ... clearly related to clinical experience. This study provides evidence in favour of SCT as a reliable and valid tool to evaluate the clinical reasoning of radiati...

Ngày tải lên : 09/08/2014, 09:22

6
392
0

Báo cáo khoa học: "International Conference on Advances in Radiation Oncology" docx

... Radiation Research (IARR) Asociacion Latinoamericana de Terapia Radiante Oncológica (ALATRO) International Union Against Cancer (UICC) Trans Tasmanian Radiation Oncology Group (TROG) International Network ... of proton beams are superior to those of photons • The cost of establishing and maintaining proton facilities is significant • Clinical trials are underway and over the nex...

Ngày tải lên : 09/08/2014, 09:20

10
423
0

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress Marion Ruiz, Azzeddine Bettache, Annick Janicki, Daniel Vinella, Cheng-Cai Zhang and Amel Latiﬁ Aix-Marseille ... Latiﬁ A, Ruiz M, Jeanjean R & Zhang CC (2007) PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium...

Ngày tải lên : 18/02/2014, 04:20

11
728
0

Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus inﬂuenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt

... Hemophilus in uenzae is medi- ated by toll-like receptor 2-TAK1-dependent NIK-IKK alpha ⁄ beta-I kappa B alpha and MKK3 ⁄ 6-p38 MAP kinase signaling pathways in epithelial cells. Proc Natl Acad Sci USA ... p38 mitogen-activated protein kinase signaling pathway. J Biol Chem 280, 36185–36194. 13 Shuto T, Imasato A, Jono H, Sakai A, Xu H, Watanabe T, Rixter DD, Kai H, Andalibi A, Linthicum...

Ngày tải lên : 19/02/2014, 00:20

14
366
0

Tài liệu Báo cáo khoa học: The calcium-induced switch in the troponin complex probed by ﬂuorescent mutants of troponin I doc

... data conﬁrms the role of TnI as a modulator of the Ca 2+ a nity of TnC; we show that point mutations and incorporation of 5HW in TnI can a ect both the a nity and the cooperativity of Ca 2+ binding ... relative large size and potential for forming or disrupting interactions. The incorporation of 5HW and other non-naturally occurring amino acid analogs into a protein seems...

Ngày tải lên : 20/02/2014, 11:20

8
504
0

Báo cáo khoa học: "The Nature off Affixing in Written English, Part II" pptx

... that words appearing in an admissible class for an affix A are to be excluded from membership in all classes for affixes contained in A. Thus a word belongs to the admissible class of ... listed above, both - ALIZE and -ATOR can be decomposed into sequences of suffixes already obtained. We have - AL-IZE and -AT-OR. The suffix -AR is new, but -ALIST appears to th...

Ngày tải lên : 07/03/2014, 18:20

11
348
0

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). RTEAyF was designed as such that restriction of the generated tatAyCy–strep ... substrate in the cytosol and acts as a guidance factor, targeting substrate molecules to membrane- localized TatCd by a mechanism that would be J. P. Barnett...

Ngày tải lên : 16/03/2014, 04:20

12
445
0

Báo cáo khoa học: The ﬁrst cytochrome P450 in ferns Evidence for its involvement in phytoecdysteroid biosynthesis in Polypodium vulgare doc

... phase contained 30% total protein and 56% microsomal P450. A pellet was recov- ered containing 2–3% total P450. The lower phase was carefully separated and dialysed against 10 mm Tris ⁄ acetate ... [ 3 H]20E to [ 3 H]E ratio was analysed after 24 h using HPLC. (C) Untreated calli. The biotransformation ratio was normalized to untreated calli, assigned a relative activity of 1. A,...

Ngày tải lên : 16/03/2014, 23:20

9
247
0

Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc

... complex in plastids of Arabidopsis thaliana and other Brassicaceae has been examined in detail. It is a hetero-oligomer, slightly larger than its mitochondrial counterpart (350 kDa), associating nucleus- ... have no descendant in plants: large scale alignments including more bacter- ial sequences (available at the EMBL-Align database as ALIGN_000912) place the origin of the eukar...

Ngày tải lên : 16/03/2014, 23:20

14
436
0

Báo cáo khóa học: The structure–function relationship in the clostripain family of peptidases potx

... volume of 100 lL containing 8 pmol of each primer (5¢-ATGAACA AAAATCAAAAAGTAACTATT-3¢ and 5¢-TTACCAT TGGTAATGATTAACTCCTCC-3¢), 100 ng template DNA, 0.2 m M of each dNTP, 10 mL 10· Pfu buffer and ... [42]. Speciﬁcity of a protein chemical modiﬁcation reaction can be indicated by the ability of substrate to protect against inactivation. The substrate was added to the incubation...

Ngày tải lên : 23/03/2014, 12:20

10
433
0