0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

Báo cáo khoa học:

Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

... GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherapy Chien-Yu Lin1,6, Ting-Yang Lin2, Hung-Ming Wang3, Shiang-Fu Huang4, ... the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for ... in nasopharyngeal and oral cancer cell lines. In this study, we determined clinical significance of GP96 in ORC by evaluation of GP96 expression and its association with disease prognosis in...
  • 24
  • 275
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) ... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... (DAPI) staining (B4), respectively. (B5-8) High magnificationimages of the boxed area in (B4) showing RPE65c staining (B5), GS staining (B6), merged RPE65c and GS staining (B7), and DAPI staining(B8),...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... such a distinction is prevalent in many other sounds, some of whichare (a) nasals in Tamil (Shanmugam, 1972) and Malayalam (Shanmugam, 1972; Ladefoged and Maddieson, 1996), (b) laterals in Albanian ... inventories: A complex network ap-proach. In COLING-08, pages 601–608.J. R. Quinlan. 1993. C4.5: Programs for MachineLearning. Morgan Kaufmann.S. V. Shanmugam. 1972. Dental and alveolar nasals in Dravidian. ... 0. This indicates that though3Binning is the process of dividing the entire range of a variable into smaller intervals and counting the number ofobservations within each bin or interval. In...
  • 9
  • 703
  • 1
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T.,Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identificationof nucleolin as a binding protein for midkine (MK) and heparin-binding ... nucleolin was generated by PCR amplificationusing total first-strand cDNA as template and the followingoligonucleotides: 5¢-TGGTATGACTAGGAAATTTGGTTATGTG-3¢ and 5¢-GACAGAAGCTATTCAAACTTCGTCTTC-3¢. ... retained on an affinity matrixcontaining purified Lf. In view of this and of a previousobservation pointing out that nucleolin serves as a bindingprotein for various ligands, we investigated...
  • 15
  • 509
  • 0
Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

... ligand by the protein. In this analy-sis, we have investigated the cases of donor (approachof many acceptors towards a donor) and acceptor(approach of many donors towards an acceptor) furca-ted ... it is amazing to see a large number (> 50)of such interactions in single proteins as in case ofenzymes carbamoyl phosphate synthetase, malatesynthase G (PDB code 1d8cA) and glucose oxidase(PDB ... hbplus[40] and the results are compared. The SHBs involvingnitrogen and oxygen atoms have been defined according tothe distance and the angle criteria, d (D -A) < 2.7 A ˚ and h (D-H -A) ‡ 150°. A distance...
  • 14
  • 421
  • 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... ligand also changes, resulting in a nonproductivebinding mode. Our data indicate an important role for the interactions between the CoA substrate sulfurgroup and the thiolase active site in assuring ... and con-taining Phe235) is coloured purple and the catalytic Cys89 is coloured dark blue. His156 at the entrance of the pantetheine-binding cavity is coloured orange. Note how the CoA interacts ... atom, such asthose in CoA and SPP. This mode of binding placesthe terminal oxygen atom further away from the centerof the catalytic cavity and, in this structure, oxyanionhole I has a water molecule...
  • 13
  • 472
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Foliation of spruce in the Giant Mts. and its coherence with growth and climate over the last 100 years" pdf

... sets and radial increment can beconsidered a natural ageing effect probably caused byage-related declining leaf area index and primary pro-ductivity as, for example, described by Mencuccini and Grace ... a loss of information and of masstransfer from the assimilative apparatus. It should be mentioned that there was no indication offorest decline from the data obtained. A slightly declin-ing ... needle traces of pine (Pinussylvestris L.) to record past needle retention and annualneedle loss and used this information, for example, in forest pathology [17]. Sander and Eckstein [25, 26]applied...
  • 9
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx

... of carcinomaassociated with ulcerative colitis is adenocarcinoma [2].We report this case because of the fact that SCC,instead of adenocarcinoma, on a background of ulcera-tive colitis is a ... histolo-gical type of carcinoma associated with ulcerative colitis is adenocarcinoma [2]. We present a case of primaryrectal small cell carcinoma in a patient with a history ofulcerative colitis, ... demonstrating a rectal tumor extending between 2 cm proximally to theanal verge and 7 cm in the rectal canal, and enlargedadjacent lymph nodes. Abdominal, chest and brain com-puterized tomography...
  • 5
  • 478
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Does Doxycycline work in synergy with cisplatin and oxaliplatin in colorectal cancer?" ppt

... primersused are – GAPDH Forward – 5'-AACTTTGGCATTGT-GGAAGG-3' Reverse 5'-GGAGACAACCTGGTCCTCAG-3' and Caspase-3 Forward -5'-TGTCATCTCGCTCTGGTACG-3' Reverse -5'-AAATGACCCCTTCATCACCA-3'The ... significantdifference in the caspase 3 activity in HT 29 cells treatedwith cisplatin and oxaliplatin alone in comparison withcombination of cisplatin/oxaliplatin and doxycycline (fig-ure 4). Although the caspase ... proliferation and invasion and toinduce apoptosis in colorectal cancer cell lines [13,14]. In this study we investigated whether doxycycline works in synergy with cisplatin and oxaliplatin or not in...
  • 8
  • 252
  • 0
báo cáo khoa học:

báo cáo khoa học: " Assessing implementation difficulties in tobacco use prevention and cessation counselling among dental providers" potx

... Institute for Health and Welfare; 2009.6. Helakorpi S, Laitalainen E, Uutela A: Health Behaviour and Health amongthe Finnish Adult Population. The National Institute for Health and Welfare; 2009.7. ... detailedinformation on the participants, the exclusion criteria, and the setting.Statistical analysisEstimates of internal consistency were calculated for thetheoretical domains and factors ... data analysis and wrote the first draft of the paper, as well assubsequent redrafts. SM and THK were theoretical and methodologicaladvisers. All authors advised on clinical and methodological...
  • 10
  • 340
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam