Báo cáo khoa học: "Vacuum-assisted breast biopsy: A comparison of 11-gauge and 8-gauge needles in benign breast disease" pptx
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... recognized by mAbs A2 and A5 , and amino acid residues 202–206 by mAb C,respectively. For this reason the reduced reactivity of mAbs A2 and A5 with Gly86Asp and Arg84Gln sub-stituted ASA and mAb C with ... reported that a certain mutant of a1 -AT is retained in the ER and degraded by nonpro-teasomal pathways [7]. This mutant could be stabilizedby the addition of phosphatase inhibitors PAO and SOV. ... homogen-ates with the polyclonal ASA antiserum.Precipitated ASA was quantified afterSDS ⁄ PAGE with a bio-imaging analyser(Fujifilm). Columns show mean, minimal and maximal deviation of arbitrary...
- 10
- 504
- 0
báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx
... gastrointestinal tract: a paradisefor acronyms (GUMP, GIST, GANT, and now GIPACT). Implications of c-kit in genesis, and yet another of many emerging roles of the interstitialcell of Cajal in the pathogenesis ... pathogenesis of gastrointestinal disease. Adv AnatPathol 1999, 6:19-40.13. Miettinen M, Sarlomo-Rikala M, Lasota J: Gastrointestinal stromal tumours.Ann Chir Gynaecol1998, 87:278-281.14. Chiappa A, ... immunohistochemical markers have revolutionised the classification of gastrointestinal stromal tumours (GISTs) whilst tyrosine kinase inhibitors (imatinib) have had a significant impact onthe treatment of advanced...
- 4
- 296
- 0
Báo cáo khoa học: "Association between intratumoral lymphatic microvessel density (LMVD) and clinicopathologic features in endometrial cancer: a retrospective cohort study" pdf
... theinfluence of intratumoral lymphatic microvessel density (LMVD) on survival in endometrial cancer are available. Ouraim was to assess the intratumoral LMVD of endometrial carcinomas and to investigate ... surgical staging and evaluation of intratumoral LMVD and other histologic variables. Lymphaticmicrovessels were identified by immunohistochemical staining using monoclonal antibody against humanpodoplanin ... 105:103-104.14. Tavassoli FA, Deville A: Pathology & Genetics Tumours of Breast and FemaleGenital Organs Lion: International Agency for Research on Cancer - IARCPress 2003.15. Alkushi A, Abdul-Rahman...
- 7
- 311
- 0
báo cáo khoa học: "Boerhaave syndrome as a complication of colonoscopy preparation: a case report" ppt
... persistent and slightly increas-ing back pain, which started immediately after vomiting,diagnostic investigations by esophagogastroscopy and CT scan with oral CM easily revealed a Boerhaave per-foration ... Wedemeyer, Johannes Hadem, Niels CHellige and Camilla Regler.Authors’ contributionsNE and JK had the idea of reporting this case. NE was in charge of ourpatient, and diagnosed and treated our patient. ... 4 A computed tomography (CT ) scan with oral contrastagent (CA) revealed only a thin CA line between the lumen of the esophagus and the mediastinal paraesophageal abscess/CAdepot (es, esophagus;...
- 5
- 398
- 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... AlaP2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K ... ggcgtcatcggtggagggctttttggcaccaaaaag Val16, Val17 and Leu18 to GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K2 4A F gctttttggcaccaaagccctcggctccatcgg...
- 15
- 532
- 0
Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt
... up–up–down–down core, also called anantiparallel-stranded core in the literature) (Fig. 2C); and (d) two strands across one diagonal are oriented in one direction and the two remaining strands acrossthe ... Virno A, Pagano B, Virgilio A, Di Micco S,Galeone A, Giancola C, Bifulco G, Mayol L & Randa-zzo A (2007) Structural and thermodynamic studies of the interaction of distamycin A with the parallel ... October2009)doi:10.1111/j.1742-4658.2009.07464.xTelomeres play an important role in cellular aging and cancer. Humantelomeric DNA and RNA G-rich sequences are capable of forming a four-stranded structure, known as the G-quadruplex. Such a structure...
- 11
- 480
- 0
Báo cáo khoa học: The lactate dehydrogenases encoded by the ldh and ldhB genes in Lactococcus lactis exhibit distinct regulation and catalytic properties ) comparative modeling to probe the molecular basis pdf
... MG1363 and FI9078 were amplified by PCR with primers LdhB1(5¢-GTAATTATCATAGAGAGTTTTTAGGAG-3¢) and LdhB2 (5¢-CAAATCCTGTTCCAATCACGA-3¢), designedon the basis of available sequences of rlrD and ldhB ... sufficient to sustain the lactate flux.Therefore, there must be an additional factor actingas an inhibitor of LDHB, and the best candidate isintracellular lactate. At an external pH of 5.5 (orlower), ... proteinconcentration was determined by the method of Bradford[33] using BSA as a standard.The kinetic parameters Km, Vmax and Kactwere estimatedwith microcal origin (Microcal Software, Inc., North-ampton,...
- 13
- 464
- 0
Báo cáo khoa học: "An Architecture for Dialogue Management, Context Tracking, and Pragmatic Adaptation in Spoken Dialogue Systems" pot
... Natural ~ Context 'Language Tracking aterpretation (on Input) Natural Language Generation Dialogue Manager Pragmatic Adaptation (on Input) Back-End " ~ Pragmatic Adaptation ... and translation of natural language interpretations into functional interface languages of back-end systems. Future work includes investigation of issues raised when a human is engaged in ... providing information processing of a computer and is capable of action in the physical world. Star Trek's "Universal Translator" is capable of automatically interpreting between any...
- 8
- 408
- 0
Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx
... metal-to-ligandcharge transfer band at approximately 520 nm [27].Substrate binding adjacent to the Fe(II) is proposed toweaken binding of the remaining coordinated water,thus enabling the binding of ... signal wassuppressed by presaturating its resonance. Spectra wereobtained at 75 s intervals and integrated using absoluteintensity scaling to monitor changes in the intensity of sig-nals of interest. ... Authors Journal compilation ª 2010 FEBS and distribution of the hypoxia-inducible factorsHIF-1alpha and HIF-2alpha in normal human tissues,cancers, and tumor-associated macrophages. AmJ Pathol...
- 11
- 457
- 0
Báo cáo khoa học: Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes doc
... (5¢-AAAAAGCAGGCTACATGGTGGTTAAAGTGTATGGTGCAAC-3¢) and GST-1-r (5¢-AGAAAGCTGGGTTTATTTTGGGAGATCCATAACTTTTCTCC-3¢)for the first round of PCR; and attB1 (5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3¢) and attB2 (5¢-GGGGACCACTTTGTACAAGAAAGCTGGGT-3¢) ... sequences of primers were: GST-0 and GST-R-1 (5¢-GATATGAGGGCATCTAAAAATTATT-3¢) forPfGST1; PfCHI-2 (5¢-CAAAATGTCTGTGACTCAAGTCC-3¢) and CHIseq-r-1 (5¢-GACATTCATTGGTCACTGATAAGCG-3¢) for PfCHI1; and ... Nishiyama Y, Hirai MY, Yano M, NakajimaJ, Awazuhara M, Inoue E, Takahashi H, GoodenoweDB, Kitayama M et al. (2005) Functional genomics byintegrated analysis of metabolome and transcriptome of Arabidopsis...
- 9
- 438
- 1
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ