Báo cáo y học: " Functional inhibition of NF-κB signal transduction in αvβ3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant IκB gene" ppsx

Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

... sequence, was compared with sequences in the GenBank database using BLAST Search Program (NCBI, Bethesda, MD). Myotoxicity in vivo Myotoxicity was analyzed by quantification of plasma creatine kinase ... (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, ven...
Ngày tải lên : 21/02/2014, 01:21
  • 11
  • 620
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... 2002 Small heat shock /a- crystallin protein from Artemia (Eur. J. Biochem. 269) 937 Functional analysis of a small heat shock /a- crystallin protein from Artemia franciscana Oligomerization and thermotolerance Julie ... thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously devel...
Ngày tải lên : 22/02/2014, 04:20
  • 10
  • 495
  • 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

... purified by immobilized metal ion a nity (A) or immunoaffinity chromatography using anti-histidine Igs (B). Results were analysed by Western blot as in Fig. 1, or by autoradiography of 35 S-labelled ... purification, a recombinant version was made containing a C-terminal myc tag followed by a His 6 sequence, by cloning the CCR5 gene into a pcDNA3.1 myc-his vector, and tra...
Ngày tải lên : 08/03/2014, 09:20
  • 12
  • 541
  • 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

... a- D -galactopyranoside, a- L -arabinopyranoside, b- L -arabinopyranoside, a- L -arabino-furanoside, a- D -man- nopyranoside, a- D -mannopyranoside, a- D -fucopyranoside, a- D -xylopyranoside, a- L -rhamnopyranoside) ... beta-glucosi- dase. Patent WO 99/03874. 36. Yahata, K., Mori, K., Arai, H., Koide, S., Ogawa, Y. , Mukoyama, M.,Sugawara ,A. ,Ozaki,S.,Tanaka,I.,Nabeshima ,Y...
Ngày tải lên : 08/03/2014, 16:20
  • 10
  • 775
  • 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... TGCTTCATCTTG CTGACGTGTACGTGGGACT C27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGC C29 5A AAAATGGCCTACAGTTTA GCTCGGTACC W31 5A CAGAATC GCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT C32 6A GTCAAGGAAGAAGCATCTGAGA GCCTAGTCTAGATAT 234 ... AAATGAGCCCAACAAAG CCGAGAAAAACATT I9 7A- R9 8A AATTTGATGCTCGACAGGCT GCCGCGGAGACATGG W10 1A CAATCCGGGAGACA GCTGGTGATGAAAA F11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTT...
Ngày tải lên : 08/03/2014, 16:20
  • 7
  • 404
  • 0
Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt

Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt

... residues are part of the c c binding interface, but do not play a key role in binding. The loss of binding affinity of the four variants I10 0A, L10 2A, Y1 0 3A a nd L20 8A i s not likely to be c aused by ... Ishii,N.,Asao,H.,Kimura ,Y. ,Takeshita,T.,Nakamura,M., Tsuchiya, S., Konno, T., Maeda, M., Uchiyama, T. & Sugamura, K. (1994) Impairment of ligand binding and growth...
Ngày tải lên : 08/03/2014, 16:20
  • 10
  • 447
  • 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

... allophycocyanins and phycocyanins, HPLC separation allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak. This was facilitated by the fact ... were phycocyanin and allophycocyanin, although at different stoichiometric ratios. In particular, band 2 contained the highest amount of both, with a significant reduction 7...
Ngày tải lên : 08/03/2014, 16:20
  • 9
  • 477
  • 0
Báo cáo Y học: Growth inhibition of mammalian cells by eosinophil cationic protein pptx

Báo cáo Y học: Growth inhibition of mammalian cells by eosinophil cationic protein pptx

... four amino-acid residues (in bold letters) as also indicated by the arrow at the bottom. RNase activity against yeast RNA (B) and bactericidal activity against S. aureus (C) of each ECP (d)and(À4) ... such as interleukin-4, are capable in some cases of mediating regression of tumors [53,54]. In ammatory in ltrates comprised of eosinophils may also play an important role at the...
Ngày tải lên : 17/03/2014, 17:20
  • 10
  • 423
  • 0
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx

Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx

... plas- mid extending to nucleotide )126 served as a template. An antisense (5¢-CACTGTTTGCTTATATTTCAATGGAA TAAAGTCCAGCTCTAGC-3¢; exchanged bases in bold) and sense (5¢-GCTAGAGCTGGACTTTATTCCATT GAAATA-TAAGCAAACAGTG-3¢) ... rifampin inhibit Bsep promoter activity they are capable of causing cholestasis by the reduction of canalicular bile acid transport capacity. In contrast with b-...
Ngày tải lên : 17/03/2014, 23:20
  • 9
  • 556
  • 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

... (NdeIorBglII). aac Oligonucleotide sequence aac1 (A. t.) Sense 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢ Antisense 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢ aac2 (A. t.) Sense 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢ Antisense ... 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢ Antisense 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢ aac3 (A. t.) Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢ Antisense 5¢-GGGCTATTCTTTCATCATCCTCATCG-3¢ aac1 (S.t.)...
Ngày tải lên : 18/03/2014, 01:20
  • 10
  • 486
  • 0

Xem thêm

Từ khóa: