Báo cáo y học: "B lymphocyte stimulator (BLyS) isoforms in systemic lupus erythematosus: disease activity correlates better with blood leukocyte BLyS mRNA levels than with plasma BLyS protein levels" ppsx
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... TGCTTCATCTTGCTGACGTGTACGTGGGACTC27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGCC29 5A AAAATGGCCTACAGTTTAGCTCGGTACCW31 5A CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATATC32 6A GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT234 ... AAATGAGCCCAACAAAGCCGAGAAAAACATTI9 7A- R9 8A AATTTGATGCTCGACAGGCTGCCGCGGAGACATGGW10 1A CAATCCGGGAGACAGCTGGTGATGAAAAF11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTTGCAGCCGCGGCCAAAAATGW16 2A TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A ... TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A AGATGGGTTGGCAACTTTCGCTTCAAAAD17 7A- D17 9A- F18 1A TGAAAACCGCCAGTGCTATTGCTGTGAACAP23 3A- P23 4A CCTGACAGCAACTACGCAGCGTTCTGTTCAGC23 6A AGCAACTATCCACCGTTCGCTTCAGGGACTGE26 4A TGCTTCATCTTGCTGACGTGTACGTGGGACTC271A...
- 7
- 404
- 0
Báo cáo y học: "The VH gene repertoire of splenic B cells and somatic hypermutation in systemic lupus erythematosus" potx
... VH gene < /b> repertoire < /b> of < /b> splenic < /b> B cells and somatic hypermutation in systemic lupus erythematosusNicola L W Fraser1, Gary Rowley1, Max Field2 and David I Stott11Division of < /b> Immunology, Infection ... 1, and has two distinct areas of < /b> staining for FDC and one large area of < /b> B cells encompassing both FDCregions. Very few T cells could be seen within GC A and B, and no plasma cells could be seen ... steadily during expansion of < /b> B- lymphocyte clones in the dark zone of < /b> the GC. This clonal evolution occursindependently in each GC, because little trafficking of< /b> B cells between GCs has been observed...
- 8
- 378
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... signaling via CD20CommentaryB cells as a therapeutic target in autoimmune diseaseJörg J Goronzy and Cornelia M WeyandDepartments of Medicine and Immunology, Mayo Clinic, Rochester, MN, USACorresponding ... diseases. Preliminary clinical studies suggest therapeutic benefits in patients with classicautoantibody-mediated syndromes, such as autoimmune cytopenias. Treatment responses in rheumatoid arthritis ... still has anaccepted role in thrombotic thrombocytopenic purpuraand cryoglobulinemia; however, in other chronic inflamma-tory diseases, plasmapheresis has had disappointingresults. After 1980,...
- 5
- 410
- 0
Báo cáo y học: " From antibody insult to fibrosis in neonatal lupus – the heart of the matter" pps
... autoimmunityoffers an exceptional opportunity to examine the effectorCommentary From antibody insult to fibrosis in neonatal lupus – the heart of the matterJill P Buyon and Robert M ClancyDepartment ... sections from several cases of CHB/myocarditiswith varying degrees of pathology parallel the resultsobtained exploiting in vitro coculturing systems. Physiologicapoptosis may initiate an inflammatory ... scarring seen in autoantibody-associated CHB. The expression of specific combinations of cytokines may ultimately provide the explanation.Conclusions In summary, immunohistological analyses of availablecardiac...
- 5
- 356
- 0
Báo cáo y học: "B lymphocytopenia in rheumatoid arthritis is associated with the DRB1 shared epitope and increased acute phase response" docx
... rheumatoid factor; SE = HLA DRB1 shared epitope. Available online http:/ /arthritis- research.com/4/4/R1Research articleB lymphocytopenia in rheumatoid arthritis is associated with the DRB1 shared ... lymphocytes is plottedon the x axis, and the number of patients in each frequency range is plotted on the y axis. The overlays represent the Gaussian frequencydistributions fitted to the two ... relevance of B lymphocytopenia in SE-positive RA will be further investigated in longitudinal studies.Keywords: antibodies, B lymphocytes, major histocompatibility complex, rheumatoid arthritis Page...
- 9
- 351
- 0
Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf
... functionally distinct withregards to production of cytokines and extracellular matrix[16,17] and it was recently demonstrated that only Thy-1+ve fibroblasts are capable of differentiating into myofibroblastsafter ... of myofibroblasts in dcSSc skinDetection of myofibroblasts in dcSSc skin. Cryosections from (a) nor-mal and (b-f) dcSSc skin were stained with an antibody against α-SMA. In normal skin, α-SMA ... skinThe distribution of myofibroblasts was investigated using the 1A4 monoclonal antibody against α-SMA. In normal skin, α-SMA immunostaining was predominantly restricted to microv-ascular pericytes, ...
- 11
- 397
- 0
Báo cáo y học: "B lymphocyte stimulator (BLyS) isoforms in systemic lupus erythematosus: disease activity correlates better with blood leukocyte BLyS mRNA levels than with plasma BLyS protein levels" ppsx
... disease activity and full-length BLyS or BLyS mRNA levels than that between disease activity and total BLyS (including BLyS) protein levels suggest that full-length BLyS and/or BLyS mRNA levels ... circulating levels of BLyS protein. Accordingly, we assessed peripheral blood leukocyte levels of BLyS mRNA isoforms (full-length BLyS and BLyS) and plasma BLyS protein levels in patients with ... betweenfull-length BLyS or BLyS mRNA levels and plasma immu-noglobulin levels again highlight the greater ability of BLyS mRNA levels, compared with plasma BLyS protein levels, toreflect ongoing BLyS overproduction.At...
- 12
- 350
- 0
Báo cáo y học: "The role of aldosterone blockade in murine lupus nephritis" pdf
... therapeuticstrategies of chronic renal injury: renoprotective effects of aldosterone blockade. J Pharmacol Sci 2006, 100:9-16.23. Teplitsky V, Shoenfeld Y, Tanay A: The renin-angiotensin system in lupus: physiology, ... [10-12]). Aldosterone also exerts proinflammatoryeffects in the kidney and other tissues [13,14], such as leuko-cyte infiltration and increased expression of inflammatorycytokines. In addition, aldosterone ... understanding of the pathophysiology of lupus nephritisand the clinical utilization of aldosterone blockade in other dis-eases. We undertook this study to characterize better theeffects of aldosterone...
- 9
- 663
- 0
Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt
... this article as: James et al.: Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled ... prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trialAlicia M James1*, Cylie ... required.Thisstudyaimstocomparetwoclinicallyapplied treatment options for the management of posterior heel pain associated with the clinical diagnosis of calcaneal apophysitis. Method Study DesignThis is a factorial randomised controlled trial;...
- 7
- 516
- 0
Báo cáo y học: "Abdominal muscle fatigue following exercise in chronic obstructive pulmonary disease" docx
... expiratory muscle fati-guing protocol, than following an equivalent exercise duration when not first fatigued [36]. Interestingly, in that study subjects exercising with prior expiratory mus-cle fatigue ... muscle fatigue to develop in healthy individuals [18,19]. In COPD, the abdominalmuscles are frequently recruited even during restingbreathing [20]. When walking to exhaustion, inspiratorywork ... parameters is interesting. This was not reflected in differences in the symptoms limiting exercise, thedegree of dynamic hyperinflation that occurred or in oxygenation during exercise. Gas transfer...
- 7
- 270
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
... of 14 RESEARC H ARTIC L E Open AccessB-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by ... shown). The inhibition of BLyS, APRIL, and the heterotrimers by atacicept is consistent with the observed effects of atacicept and/ or murine TACI-Ig in preclinical and clin-ical studies. In mice and ... from patients with SLE and RAused in this study, levels of BLyS, APRIL, and heterotri-mer were elevated in patients with SLE, compared with the sera of healthy donors. The detection of a singleligand...
- 14
- 460
- 0
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... receptor signaling architecture in normal and systemic lupus erythematosus T cells. SLE, systemic lupus erythematosus; TCR, T cell receptor.Normal T cell SLE T cell ααSLE T cell αAggregated ... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. De cient expression of the T cell ... Delaney N, Tsokos GC: Reconstitution of de cient T cell receptor zeta chain restores T cell signaling and augments T cell receptor/CD3-induced interleukin-2 production in patients with systemic...
- 10
- 347
- 0
Báo cáo y học: "Recently published papers: Novel therapies in chronic obstructive pulmonary disease, cardiac chemicals and intensive care outcomes" ppt
... multicentreobservational study examining the relationship between theamount of energy and protein administered during ICU stay and clinical outcomes in critically ill patients, and the extent towhich ... Enquiry into Patient Outcome and Death) interest recently and data into provision of care and outcomes have been published [13]. French investigatorsFloccard and colleagues [14] have looked into ... Confidential Enquiry into Patient Outcome and Death: Adding Insult to Injury - a Review of the Care ofPatients Who Died in Hospital with a Primary Diagnosis ofAcute Kidney Injury (Acute Renal Failure)...
- 3
- 149
- 0
Báo cáo y học: "Another step for noninvasive ventilation in chronic obstructive pulmonary disease patients" pot
... strategy (NPPV combined with FBO in COPD with hypercapnic encephalopathy) in the most challenging patients.AbbreviationsCOPD, chronic obstructive pulmonary disease; FBO, breoptic bronchoscopy; ... Naldi M, Maccari U: Early beroptic bronchoscopy during non-invasive ventilation in patients with decompensated chronic obstructive pulmonary disease due to community-acquired-pneumonia. Crit ... G: Another step for noninvasive ventilation in chronic obstructive pulmonary disease patients! Critical Care 2010, 14:163.Jaber and Chanques Critical Care 2010, 14:163 http://ccforum.com/content/14/3/163Page...
- 2
- 188
- 0
Báo cáo y học: " CD4+ lymphocyte adenosine triphosphate determination in sepsis: a cohort study" pdf
... the CD4+ lymphocyte ATP content, and arguably, the immune sta-tus of an individual patient. We have also demonstratedthat a lower CD4+ lymphocyte ATP content is associatedwith a higher mortality, ... be associated with mortality in severalpatient populations [9].Interestingly, data are beginning to accumulate sup-porting the notion that viruses may reactivate in immu-nocompetent patients ... immune status was determined by measuring the CD4+ lymphocyte adenosine triphosphate (ATP) content after mitogen stimulation in whole blood.Results: The measured CD4+ lymphocyte ATP content at the...
- 6
- 207
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM