Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

... in a uniform array at the palisades, similar to hyaline cartilage. Gross appearance of a cartilage defect in the patella groove implanted with a complex between adherent bone marrow cells and ... developed a new ultrasonic evaluation systemfor articular cartilage and showed that this system can quanti-tatively evaluate cartilage degeneration clinically [6,7]. The analysis system is based ... ultrasonography was used to assess cartilage degeneration quantitatively. Chérin and colleagues[28] revealed a relation between quantitative ultrasound and maturation-related changes in rat cartilage. ...

Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx

... described that thenar atrophy often proceedshypesthesia in the median distribution for many monthsor many years and the onset of thener muscle atrophy wasalways gradual. Also if the paralysis had existed ... Sakai, Japan, 2Department of Orthopaedic Surgery, Hosigaoka Kouseinenkin Hospital, Hirakata, Japan and 3Department of Orthopaedic Surgery, Toyonaka Municipal Hospital, Toyonaka, JapanEmail: ... stand-ard deviation (SD) using statistical software (Statview4.5J, SAS, Cary, NC). The significance of differences between the values was analyzed using the Mann-WhitneyJournal of Brachial...

Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx

... iPsbW, the forward and reverse primers were ATGGGTAAGAAGAAGGGAGGA and TCTCTTTGCTCGGACGCG, respectively. For sPsbW, the forward and reverseprimers were ATGGAGACAAAGCAAGGAAAC and TCTCTATTTGCTCGGACGCG. ... preceding A1 and A2 . The TPPcleavage sites are denoted by asterisks. The approximate cleavage site between the C-terminus of A1 and the signal peptide of A2 is denotedby +? (the identity of the responsible ... which samples were analyzed of the chloroplasts (lanes C), chloroplasts after thermolysin treatment (C+) and the stromal (S) and thylakoid (lanes T) fractions after lysis of thermolysin-treated...

Báo cáo y học: "Put your heart into the joint benefits of statins" pps

... Therapy Vol 5 No 4 Hall The recognition that systemic inflammatory diseases areassociated with accelerated atherosclerosis offers the prospect of reducing morbidity and mortality of affectedpatients ... farnesylpyrophosphate and geranylgeranyl pyrophosphate, whichare required for post-translational prenylation of a range of moieties, including signalling intermediaries, tRNA and coenzyme Q in the ... Mehta [3]). HMG-CoA reductaseis an enzyme of the cholesterol biosynthetic pathway thatcatalyses the conversion of HMG-CoA to mevalonic acid.Downstream metabolites in this pathway include farnesylpyrophosphate...

Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx

... 6:6http://www.ethnobiomed.com/content/6/1/6Page 6 of 8 The Garasiya tribe The Garasiya people are main inhabitant of surround-ings areas of the Mount Abu wildlife sanctuary, Pind-wara and Aburoad tehsil of Sirohi district of Rajasthan.Earlier ... of frog, honey, mi lk of goat, and ash of peacock feathersaresomeofthem.Goat(Capra aegagrus hircus )and honey bee (Apis cerana indica )aremostfrequentlycited animal species among these ... using relevant and standard literature [35,36].Data analysisFor the data analysis, fidelity level (FL) calculated thatdemonstrates the percentage of respondents claiming the use of a certain...

Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps

... rheumatoid arthritis in spite of their systemic, gastric and renal toxicities [5-11]. These cur-rently available analgesic and anti-inflammatory drugs areclearly not adequate therapy. In addition ... speed.Statistical analysisStatistical Package for the Social Sciences software (SPSSInc. Chicago, IL, USA) was used to analyze the data. Through-out the study, the mean ± standard error of means ... compares the day 0 values with the day 22values to illustrate these effects. Arthritis also caused anincrease in the stance time and the swing time from day 4onwards. Administration of GS and of...

Báo cáo y học: "kết quả can thiệp tim mạch Tại khoa nội 2 bệnh viện 103 " pot

... congenital heart diseases 10, atrial septal defect 3 and 1 hypertrophic obstructive cardiomyopathy patient. Complications have been reported: hematoma at local vascular in 14 patients (2.7%), vagus ... 2 patients (0.4%) and death in 3 patients (0.6%). The study suggested that the interventional techniques were feasible and effective for patients. * Key words: Coronary angiography; Ttransluminal ... sỹ Y học. Trờng Đại học Y Hà Nội, 2006. tr.161-164. 6. Phạm Manh Hùng et al. Percutaneous transluminal septal myocardial ablation in hypertropic obstructive cardiomyopathy: immediate and six-month...

Báo cáo y học: "Quantitative expression of osteopontin in nasal mucosa of patients with allergic rhinitis: effects of pollen exposure and nasal glucocorticoid treatment" pdf

... pro-vides the first example of the distribution in the nasalmucosa of AR patients. The expression of OPN protein in the nasal mucosa of healthy and AR subjects was predomi-nantly in the nucleus of the ... quantitative imagingsoftware (Leica QWin) with the same threshold used forall sections. The data was expressed as a percentage of total tissue area.GraphPad 5 (GraphPad Software, Inc. CA, ... nucleus of the epithelial and endothelial cells (glandular and vesicular). Similarly, OPN expression hasalso been seen intracellularly in other nasal bio psies [12],as well as bronchial biopsies...

Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

... target tissue. The use of a cellular standard generated with activatedPBMC cDNA significantly improves assay reliability byreducing variation and by simplifying assay development.Analysis of ... or the amount was correlatedto the standard curve generated on the same day. The CVwas then calculated for the five separate runs. Figure 3a shows the CV for replicate assays analyzed by the ... any particularmRNA transcript, but only provides amounts relative to the standard, similar to a standard curve in a bioassay thatprovides a reference unit of biological activity. The rawdata...

Báo cáo y học: "Quantitative ultrasonic assessment for detecting microscopic cartilage damage in osteoarthritis" pptx

... methods of the cartilage samplesSchematic illustration of the articular cartilage analysis and measure-ment methods of the cartilage samples. A reflex echogram of articular cartilage and a wavelet ... calculated automatically by a compu-ter. Articular cartilage was evaluated in vivo and in vitrowith these two indices.Figure 1Schematic illustration of the articular cartilage analysis and measure-ment ... biome-chanical analysis and the decrease in Safranin-O staining of the cartilage surface from histological analysis.There are numerous clinical methods of grading the degen-erative changes and...

Xem thêm