0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "When is a GIST not a GIST? A case report of synchronous metastatic gastrointestinal stromal tumor and fibromatosis" ppt

Báo cáo khoa học:

Báo cáo khoa học: "When is a GIST not a GIST? A case report of synchronous metastatic gastrointestinal stromal tumor and fibromatosis" ppt

... 4(page number not for citation purposes)World Journal of Surgical OncologyOpen Access Case report When is a GIST not a GIST? A case report of synchronous metastatic gastrointestinal stromal tumor ... morphological features as gastrointestinal stromal tumor (GIST) have been reported. Co-existence of GIST with these otherdiseases is rarely recognized or reported. Case presentation: We report a case of ... TKIthat was initially reported to achieve a partial responserate of 53.7% and stable disease rate of 27.9%[1]. Withthe increasing use of TKI in the treatment of advanced GIST, the pattern of disease...
  • 4
  • 297
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "WHEN IS THE NEXT ALPAC REPORT DUE" ppt

... Traditionally, the start of intensive work on machine translation is taken as being a memorand~n of Warren Weaver, then Director of the Natural Sciences Division of the Rockefeller Foundation, ... National Academy of Sciences set up an investigatory committee, the Autcmatic Language Processing Advisory C~n- mlttee (ALPAC), with the task of investigating the results so far obtained and ... started up a machine translation project with the declared aim of building a pilot system to convince potential funding agencies of the feasibility and the practicability of machine translation....
  • 2
  • 290
  • 0
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx

Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx

... holoenzyme RNAPIIplus the Mediator complex from Sc. pombe and demon-strated that it is able to stimulate basal transcription and support activated transcription in the absence of TAFs.Materials and ... carry out basaltranscription at a level that was twofold greater than thatobserved with affinity-purified RNAPII (Fig. 2B, comparelanes 6 and 7 with lanes 8 and 9). In this series of assays, weused ... activationdomains of CTF and Sp1 in the reconstituted assay usingthe RNAPII holoenzyme and found that Gal4-CTF is ableto activate basal transcription (Fig. 5E, compare lanes 1, 2, and 3) whereas...
  • 12
  • 412
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Colonoscopy is mandatory after Streptococcus bovis endocarditis: a lesson still not learned. Case report" docx

... (normal 0–10 mm/h). Tumor markers including CEA and Ca 19-9 were also evaluated and resulted not increased and fecal occult blood test wasnegative. X-ray examination of the chest was normal and ECG ... stomach cancer). Thepatient was a hard smoker and his personal pathologicanamnesis didn't show any relevant disease other thantraumatic bone fractures. The physical examinationrevealed good ... University of Pavia, Istituto di Chirurgia Epatopancreatica, Fondazione IRCCS Policlinico San Matteo, Pavia, ItalyEmail: Alberta Ferrari* - albertaferrari@libero.it; Ivan Botrugno - albertaferrari@libero.it;...
  • 5
  • 238
  • 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

... 2:5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTCTACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGCAGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer4: 5¢-(GGGGAATTCATGGCTAACTATGAATTTAGCCAG)-3¢.The E150L PCR product was ... primer 1:5¢-(TACTTGGATCCAGGGAAAGATGTTCACCCTGctGGACACCCTG)-3¢; CD38-E150L, primer 2: 5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTCTACACG)-3¢; CD38-G68E, primer 1: 5¢-(GACATCTTCCTCGagCGCTGCCTCATC)-3¢; ... serumalbumin (BSA) (Research Organics, Del Mar, CA, USA) and incubated with rabbit polyclonal antibody againstCD38 [28] overnight at 4 °C followed by an anti-rabbit–HRP (DAKO, Carpinteria, CA,...
  • 10
  • 448
  • 0
báo cáo khoa học:

báo cáo khoa học: " Ethylene is involved in pistil fate by modulating the onset of ovule senescence and the GA-mediated fruit set in Arabidopsis" docx

... observed along the pistil at anthesisor at 1 DPA (data not shown). It is remarkable to notethat the temporal and spatial gene expression patterns of genes of the ethylene biosynthesis and GUS activityin ... ctr1-1 already displayed significantly shorter pistils atanthesis, and final fruit length was also significantlyshorter than in parental plants.Activation of ethylene biosynthesis and response ... was statistically up-regulated in a biphasic fashion, with a prominent peak of expression at 2DPA and a second one at 12 DPA. Inset, the GUS histochemical assay inthe unfertilised pistils of...
  • 9
  • 409
  • 0
Báo cáo khoa học: Amyloid structure – one but not the same: the many levels of fibrillar polymorphism potx

Báo cáo khoa học: Amyloid structure – one but not the same: the many levels of fibrillar polymorphism potx

... three aspartic acidresidues (Asp9, Asp15 and Asp21) and the C-terminusexist mostly in the protonated state. This means thatglucagon has a net charge of +5 (N-terminus, His1,Lys12, Arg17 and Arg18). ... these cases, theformation of amyloid and other aberrant aggregatesrepresents an alternative type of folding that makesKeywordsaggregation; amyloid; fibrillar polymorphism;glucagon; mechanism; ... (1977)Thermodynamics of the self-association of glucagon.Proc Natl Acad Sci USA 74, 3340–3344.82 Sasaki K, Dockerill S, Adamiak DA, Tickle IJ &Blundell T (1975) X-ray analysis of glucagon and its...
  • 11
  • 400
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Delayed malignant melanoma recurrence simulating primary ovarian cancer: Case report" docx

... report Anastasios Boutis*1,2, Rosalia Valeri3, Ippokratis Korantzis1, Dimitrios Valoukas4, Ioannis Andronikidis1,5 and Charalambos Andreadis1Address: 13rd Department of Clinical ... Ioannis Andronikidis - yandron@med.auth.gr; Charalambos Andreadis - elkageba@otenet.gr* Corresponding author AbstractBackground: Metastatic involvement of the ovary from malignant melanoma is ... uncommon and presents a diagnostic challenge. Most cases are associated with disseminated disease and carry a dismal prognosis. Delayed ovarian recurrences from melanoma may mimic primary ovarian cancerand...
  • 4
  • 293
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA ... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses of nitrite appearance and disappearance ... conditions is not understood. Anal-ysis of insertional mutagenesis and complementationwork in Pseudomonas aeruginosa, Pseudomonas fluores-cens, Paracoccus denitrificans and Pseudomonas stutzerihave...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections causedby Gram-positive bacteria [9]. The antibiotic effect is based on the inhibition of bacterial cell ... formation and isomerization by PDIPDI is a catalyst of thiol–disulfide exchange reactions,including oxidation, reduction and isomerization [1].The simplest in vitro assays for catalysis of thiol–disul-fide ... rhodanese refold-ing at pH 7.2. The rate of aggregation relative to the negative con-trol in the absence of bacitracin is presented as mean ± standarddeviation (number of samples). Statistical...
  • 9
  • 620
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI