0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo lâm nghiệp: "development of winter hardiness of pine and spruce seedlings in a simulated acid rain experimen" potx

Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Development of species composition in long term simulations with an individual-tree growth simulator" pps

... site class – mean annual increment at age 100 (m3/ha) breast height diameter of tree with mean basal area (dg cm), number of trees (N/ha), basal area (G m2/ha), volume (V m3/ha) and the ... ecologi-cal demands in site conditions. Acer campestre L., Acer platanoides L. and Acer pseudoplatanus L., the native maple species in Austria, have rather different demands in climatic site ... to browsing and the eco-nomical disadvantage of fir wood, reflected in forest management practice, as they are comprised in the parameterization database of P A . is could be similarly true...
  • 7
  • 406
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Development of tertiary roads in the Lednice-Valtice Cultural Landscape" pps

... principles of rural roads and in accordance with function-ally integrated management could be applied in the landscape management of this area and also in similar ones.Keywords: tertiary road; forest ... of management and better utilization of land with 73% increase in hauling road density and 16% increase in rural cart-road density in the period under consid-eration. On the basis of evaluation ... enable the general application of acquired findings in the Lednice-Valtice Cultural Landscape and in the other areas, mainly with a similar potential of utilization and sustainable development.R...
  • 7
  • 266
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Predicting the environmental thresholds for cambial and secondary vascular tissue development in stems of hybrid aspen" pptx

... variationsare the consequence of the balance maintained between the rate of periclinal cambial cell divisions and the rate of differentia-tion of the cells as xylem fibres and parenchyma. In ... of the cambium (active and inactive or dor-mant) may also be regulated by means of a biotic variable towhich is linked a critical abiotic variable (such as one of thethree environmental factors ... Woody Plants,Academic Press, San Diego, 1997.[12] Lachaud S., Participation of auxin and abscisic acid in the regula-tion of seasonal variations in cambial activity and xylogenesis,Trees 3 (1989)...
  • 9
  • 411
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Development and characteristics of microsatellite markers for sugi (Cryptomeria japonica D. Don) derived from microsatellite-enriched libraries" ppt

... CAATGCCAACTTAGAAGAC 60 30 AB161635 (GA)43 298 PerfectCJS0268 CCTTAGAAAGCTATGCCAC GCAACGCATCCATAATACC 60 30 AB161636 (AC)53 352 PerfectCJS0331 GGAGAGATAGACGACAAAAGAG CCATCTTGCTAATCTGTCC 60 30 AB161637 ... CTAAAGAATAGATGACTCCAC TATAACGCTTTTGCCCTCA 60 30 AB161640 (GA)64 337 PerfectCJS0401 GATCTAAACTTGAGCATAAC CAATCCTGTCTCCATACCC 55 30 AB161641 (CG)8(GA)54 222 CompoundCJS0455 GTTACTTTGAAAAATGAGCC ... GAGGCAAAGGTAGAGGTGAA CCCTCCCAAGTTCTAAGTAA 60 30 AB161672 (GA)9 167 PerfectCS2260 GGAGGGTAGATAGAGAAAATAG TCTACCTACCTCTCTTCCCA 60 30 AB161673 (GA)39 206 PerfectCS2294 TTTCCTCTTCCATCTCACCC TCATGCTCCATTACGAATCT...
  • 7
  • 336
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Modelling the biomechanical behaviour of growing trees at the forest stand scale. Part I: Development of an Incremental Transfer Matrix Method and application to simplified tree structures" pptx

... simple. In the peripheral layer, where the MSoccur, the axial strain increment ( ) can be split into elastic axialstrain increment ( ) and axial MS ( ). Generalisation at any pointM of is given ... characterise timber quality in Aquitaine maritime pine forests for instance, foresters oftenlook at the stem base leaning and intensity of the basal curvaturewhich provide good indicators of ... softwareAMAPpara and its biomechanical function AMAPméca. The com-puted structure was taken as a reference in order to carry out a numer-ical evaluation of the ITMM biomechanical model. The advantage...
  • 13
  • 377
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps

... population of paths of each tree (eq. [1]) and the true totals and variances of the target variables and the estimates of the totals, respectively.Choice of the auxiliary variable and variance of the ... data were used: Norway spruce (Picea abies [L.] Karst.), European mountain ash (Sorbus aucuparia L.) and Monterey pine (Pinus radiata D. Don). e results clearly indicate that the choice of ... at the base of the segment, a proxy of the volume of that part of the branch, as the auxiliary variable. Each path was terminated when a diameter of 5 cm or less was encountered. e same auxiliary...
  • 14
  • 335
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Contribution to the knowledge of Clethrionomys glareolus populations in forests of managed landscape in Southern Moravia (Czech Republic)" pot

... only in one case in RB locality.e sex ratio was balanced in our case in HL and RB. It is characteristic feature of stable population liv-ing in optimal habitats (A , G 1985). In HL ... m2 in size, and the mean amount of mast was determined. In all trial plots, the methodology of traditional line trapping was applied (P 1975). Snap traps were used and baited with a wick ... third was a pheasantry with a variable mixture of forest stands of various woody species and age with a permanent supply of food for pheasants and roe deer (RB). e population fluctuations in four...
  • 5
  • 368
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Contribution to the knowledge of Apodemus sylvaticus populations in forests of the managed landscape of southern Moravia (Czech Republic)" potx

... 0.001, ANOVA, Scheffe test) were significant comparing RB and HA but insignificant comparing HA and HL. Comparing only adult individuals, statistical significance was found between HA and RB individuals ... 370–376 In our case, the sex ratio was markedly in favour of females in HA and HL and balanced in RB. It is a characteristic feature of stable populations living in optimum habitats (N, ... m2 and the average amount of mast was deter-mined. e plots were selected randomly in the oak stand and the number of acorns was determined on each of the plots. e acorns were then hulled and...
  • 7
  • 389
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Stable Agrobacterium-mediated transformation of Norway spruce embryogenic tissues using somatic embryo explants" ppt

... Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Molecular and General ... embryos of Nor-way spruce was carried out by Agrobacterium tu-mefaciens strain LBA4404 containing the helper plasmid pAL4404 and binary vector with the gus-intron chimeric gene and nptII selectable ... Consistent and stable expression of the nptII, uidA, and bar genes in transgenic Pinus radiata after Agrobacterium tumefaciens-mediated transformation using nurse cultures. Plant Cell Reports,...
  • 4
  • 308
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Findings from the application of coal combustion by-products (CCB) for forest reclamation on spoil banks of the North Bohemian Brown Coal Basin" pdf

... the age of 7 years by an invariability of the achieved initial state of improvement of physi-cal soil properties (water-retaining capacity, poros-ity) and by a decrease in soil alkalinity and ... and Tilia cordata Mill. (2–15%) whereas the used containerized planting material of Pinus sylvestris L. and Pinus nigra Arn. was characterized by prac-tically no mortality (max. 1%). e majority ... with nitric and perchlo-ric acid, followed by determination of metals with an AAS – VARIAN 240 apparatus; phosphorus is deter-mined with a SKALAR flow automatic analyzer.RESULTS AND DISCUSSIONPedological...
  • 8
  • 331
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ