Báo cáo y học: "Analysis of immunoglobulin light chain rearr

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

... rearrangements in the patient s parotid gland only, as well as of Vλ1C–Jλ3 rearrangements in both the peripheral blood and parotid gland of this patient with SS. One feature of the present patient ... from the peripheral blood of the same patient. This patient manifested increased titers of autoantibodies (anti-Ro and anti-La), hypergamma- glo...

Ngày tải lên : 09/08/2014, 03:24

12
441
0

Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

... were as follows: 1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC. 2. TGF-β1, TGGACCGCAACAACGCCATCTATGA- GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC- CAGGGCT. 3. β-actin, ... obtained from the Shizuoka Laboratory Animal Center (Hamamatsu, Shizuoka, Japan). All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine (Nishinomiya,...

Ngày tải lên : 09/08/2014, 08:22

7
399
0

Báo cáo y học: "Medicinal plants used for traditional veterinary in the Sierras de Córdoba (Argentina): An ethnobotanical comparison with human medicinal uses" ppt

... valleys of the regions of Calamu- chita and Paravachasca (Santa Mar a and Calamuchita Departments) and complemented with surveys carried out in settlements near the town of La Calera, all in the area ... part/alcoholic macerate/friction and massage Rub the macerate in the back of the animal to relieve kidney pain. Lavandula officinalis var. angustifolia (D...

Ngày tải lên : 10/08/2014, 09:22

19
444
0

Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

... (HAQ) to assess functional ability [9]. The radiological damage was assessed in X-ray scans of the hands and wrists biannually (2000, 2002, and 2004), which were read centrally by a trained radiologist ... LEF, sulfasalazine cyclosporine A, aTNF and others), the following covariates were also analyzed: age at disease onset, age at baseline, gender, years of disease durati...

Ngày tải lên : 09/08/2014, 13:22

10
426
0

Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt

... preparation. ND assisted in patient recruitment, was a reader for the X-rays and assisted in manuscript preparation. ML assisted in patient recruitment and participated in data analysis. QR was a ... data entry and analysis. FMM conceived of the study and coordinated patient recruitment, data entry, data analysis and preparation of the manuscript. Acknowl...

Ngày tải lên : 09/08/2014, 01:22

9
521
0

Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx

... from the area adjacent to the main defect and pieces of tissue with a macro- scopically normal appearance of the lateral aspect of a con- dyle from each of the 12 patients were minced, and RNA was isolated ... patients in the late stages of OA, an increase in staining intensity was found in the pericel- lular space (Figure 4b). In healthy cartilage, COM...

Ngày tải lên : 09/08/2014, 07:20

10
480
0

Báo cáo y học: "Receptor for advanced glycation end products Glycine 82 Serine polymorphism and risk of cardiovascular events in rheumatoid arthritis" potx

... Silman AJ: Baseline levels of C-reactive protein and prediction of death from cardiovascular disease in patients with inflammatory pol- yarthritis: a ten-year followup study of a primary care-based inception ... single time point, which occurred at variable times after com- mencing a variety of antirheumatic drugs rather than at baseline. In RA, proinflammatory ligands...

Ngày tải lên : 09/08/2014, 10:20

8
330
0

Báo cáo y học: "MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppsx

... KP assisted in patient recruitment and participated in data entry. JL participated in data entry and analysis. FMM conceived of the study and coordinated patient recruitment, data entry, data ... preparation. ML assisted in patient recruitment and participated in data analysis. QR was a reader for the X-rays and assisted in manuscript preparation. ER pro-...

Ngày tải lên : 09/08/2014, 13:22

9
509
0

Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

... KA analyzed and interpreted the patient data. AT, NF, KS, AT, MT and HI analyzed endoscopic data. YS, HT, TK, CT, YA, AN and SM performed the histological examination of the organs. YS, MI and ... cases of duodenal solitary Peutz-Jeghers type hamartomatous polyp. Case 1 was a hamartomatous polyp with a focus of well-differentiated adenocar- cinoma, and Case 2 w...

Ngày tải lên : 10/08/2014, 23:21

4
458
0

Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

... Karin M: The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol 2004, 25:280-288. 2. Silverman N, Maniatis T: NF-kappaB signaling pathways in mammalian and ... Analysis All graphs and statistical analyses were produced using Prism software (GraphPad Software Inc., La Jolla CA). Results TMP acts early to inhibit synthesis of TNF -a...

Ngày tải lên : 11/08/2014, 03:20

11
622
0