... effort has already been invested in mathematical
modelling of the glycolytic pathway in yeast [3–8] and in
other organisms, such as Trypanosoma brucei, the parasite
that causes sleeping sickness ... evolutionary effort required
to develop and maintain this set of biological checks and
balances is intuitively indicative of some importance to
maintaining consistent rates of glucos...
... Martin et. al. [12] define a
transportable NL interface as one
that
can acquire
a new domain model by interacting with a human
database expert. Although DATALOG does not yet
have such a ...
design of natural language interfaces that has
evolved during the development of DATALOG, an Eng-
lish database query system based on Cascaded ATN
grammar. By providing separate repres...
...
geometry of phonological features.
Phonology yearbook 2, 225-252.
Kalman, Laszl6 and Andras Kornai.
1985. A finite-state approach to
generation and parsing. Paper presented
at the Generative Grammar ... sequencing of the
activation of otherwise distinct
coalitions.
INFORMATION PROCESSING WITH
THE MOLECULAR MACHINE
The basic operation performed by the
molecular machine is...
... that are aimed at characterization of the impact
that these missense THTR1 mutations have on the expres-
sion, post-translational modification, plasma membrane
targeting and thiamine transport activity. ... expressing the indicated proteins. Net
thiamine uptake was calculated by subtraction of the radioactivity
obtained at 37 °C with that observed at 4 °C. Endogenous thiamine
transport in...
... Takeuchi M, Ogasawara S, Maruyama Y, Nakajima
T, Takaoka Y et al. (2002) Production in yeast of
alpha-galactosidase A, a lysosomal enzyme applicable to
enzyme replacement therapy for Fabry disease. Glyco-
biology ... B) Heart – endothelial staining in Fabry
mouse; (C, D) lung – epithelial cell staining
increased in Fabry mouse; (E, F) brain micro-
vascular endothelial staining in...
... level). In [10], we have formal-
ized this notion by introducing graph adjoining
grammars which generate exactly the same lan-
guages as TAGs. In a graph adjoining grammar,
/~x is represented as ... the main point
of the paper. We note that, just as in a TAG, the
elementary trees which are the domains of depen-
dencies are available as a single unit during each
step of...
... double-blind, randomized com-
parison of the efficacy and safety of intramuscular injections
of olanzapine, lorazepam, or placebo in treating acutely agi-
tated patients diagnosed with bipolar mania. ... pharmacokinetics and pharma-
cological effects of carbamazepine and carbamazepine
10,11-epoxide: An update. Clin Pharmacokinet 1986, 11:177.
84. Blackburn SC, Oliart AD, Garcia Rodr...
... using a digital
camera (DC120; Eastman Kodak, New Haven, CT, USA)
and densitometric scanning analysis software (1d main;
Advanced American Biotechnology, Fullerton, CA, USA).
Statistical analysis
All ... (bp)
CD163
(XM_053094.2)
Sense:
AGCTGGGCTGTGCAGACAACG
Antisense:
TGAATGACCCCCGAGGATTTCAGC
736
CYP 1A1
(X00469)
Sense:
CTGGTTCTGGATACCCAGCTG
Antisense:
CCTAGGGTTGGTTACCAGG
331
CYP 1A2
(X01...
... Horse-
radish peroxidase-conjugated antibody against caspase-3
(#610325) was from BD Pharmigen, and antibody against
b-actin (A5 441) was from Sigma.
Statistical analysis
All data are expressed as ... examined
the main steps involved, following the uptake of satu-
rated and unsaturated FFAs into the cells. After their
internalization, FFAs are converted to fatty acyl-CoA,
a reaction catal...