báo cáo khoa học: "Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature" ppt

... CASE REP O R T Open Access Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literatureDouglas ... douglas.mcgregor@va.gov1Department of Pathology and Laboratory Medicine, University of KansasMedical Center, Kansas City, Kansas, USAFull list of author information is available at the end of ... recovery(cases 1 and 2), postoperative death due to sepsis (case 5) and unknown (cases 3 and 4).The above case report and four previous cases showthe s imilarities among t hese five cases - highly...

Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-speciﬁc binding of a protein doc

... of a proteinRama-Haritha Pusarla*, Vinesh Vinayachandran* and Purnima BhargavaCentre for Cellular & Molecular Biology, Hyderabad, IndiaMultifold compaction of DNA due to the presence of nucleosomes ... chromatin was assembled at 50 mM salt for lanes 1–4, and at 70 mM salt for lanes 5–8. (B) IEL analysis for the chromatin assem-bled at 90 and 110 mM salt concentrations. Naked DNA (lanes 4 and ... the lac operator. Arrowheads and arrows mark the positions of the lac operators. The names of the plasmid DNAs are given for each panel. (A) IEL analysis of the chromatin assembled over plasmids...

Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

... dinitrogen by Bacteria and Archaea. Adv Microb Physiol 52, 107–227.24 Uthandi S, Saad B, Humbard MA & Maupin-FurlowJA (2010) LccA, an archaeal laccase secreted as a highly stable glycoprotein ... bothlaccases and metallo-oxidases, are well characterized ineukaryotes and bacteria, only one archaeal laccase hasbeen described so far [24]. Although the recombinantpuriﬁed McoP is similar ... mutagenesis kit (Stratagene,Santa Clara, CA, USA). Plasmid pATF-20 (containing thewild-type mcoP sequence) was used as template, and prim-ers mcoPM297Ad (5¢-CCCATGCATTTAGAAGCGGGCCACGG-3¢) and...

Tài liệu Báo cáo khoa học: Enzyme kinetics informatics: from instrument to browser pdf

... instrument,process and normalize it to agreed standards and ﬁnally transfer these data to publicly available data-bases to make them accessible.To facilitate the dissemination of data, a number of initiatives ... search capabilityfor kinetic data and corresponding metadata stored inSABIO-RK. The task of automatically ﬁnding para-meters and associated data is aided by specifying and storing metadata ... data transfer format between sources other thanSABIO-RK. Derived from the SABIO-RK databaseschema [23], it comprises kinetic laws, parameters and relevant metadata in a structured and standardized...

Tài liệu Báo cáo khoa học: Multisite protein phosphorylation – from molecular mechanisms to kinetic models pdf

... F, PaganoMA, Antonelli M, Allende CC, Pinna LA & AllendeJE (2003) A noncanonical sequence phosphorylated bycasein kinase 1 in beta-catenin may play a role incasein kinase 1 targeting of ... effec-tive rate constants of phosphorylation and dephosphor-ylation, a ran and bran, deﬁned as follows: a ran¼ðN À n þ 1 a and bran¼ nb; ð6Þwhere a and b are as given in Eqn (5). Equation (6)expresses ... calcineurin (CaN) atseveral Ser residues induces a conformational change that exposes a nuclear localization signal (NLS), leading to nuclear localization of NFAT, its binding to DNA, and maximal transcriptional...

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... (GAPDH) mRNA quantiﬁcation in coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts ... inhuman cancers.To begin functional studies of s-DAPK-1, thes-DAPK-1 cDNA was cloned into a Flag–Myc vector(Fig. 2A) , which contains an N-terminal Flag tag and a C-terminal Myc tag, and this was ... DAPK-1 and induce membrane blebbing. A function was alsoattributed to the unique tail of s-DAPK-1: it can regu-late the localization and half-life of the protein and Fig. 4. The C-terminal tail of...

Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M,Caballeria J, Pares A, Rodes J & Fernandez-Checa JC(2000) Enhanced DNA binding and activation of tran-scription factors NF-kappa B and AP-1 ... disulﬁram. Alcohol Alcohol 28,461–468.30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawa-moto T (2002) Diminished alcohol preference in trans-genic ... chem-istry-generated free radicals [27]. In diabetes, there arepathways for the increased formation of a- keto-aldehydes such as glyoxal and methylglyoxal from glyceraldehyde 3-phosphate. Autoxidation of a- hydroxy-aldehydes...

Tài liệu Báo cáo khóa học: UDPgalactose 4-epimerase from Saccharomyces cerevisiae A bifunctional enzyme with aldose 1-epimerase activity docx

... ln (a o– a e)/ (a t– a e) ¼ kt,whereao, a t,andaeare the observed angularrotations at time zero, t and equilibrium, respectively, and k is the calculated rate constant [10]. A linearincrease ... bifunctional enzyme with aldose 1-epimerase activitySiddhartha Majumdar1, Jhuma Ghatak2, Sucheta Mukherji2, Hiranmoy Bhattacharjee3 and Amar Bhaduri*1Division of Drug Design, Development and ... formation of NADH was measured at 340 nm over a linear range of 2–5 min.Mutarotase assayMutarotase activity was measured with a DIP-360 polari-meter (Jasco). This assay is based upon the change in...

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... 88,12–19.19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)Identiﬁcation of the ﬁrst archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI cancleave an RNA-DNA junction. ... chromosomal DNA during mammalian Okazakifragment processing. J Biol Chem 272, 22591–22599.9 Haruki M, Tsunaka Y, Morikawa M & Kanaya S(2002) Cleavage of a DNA-RNA-DNA ⁄ DNA chimericsubstrate ... [19,20]. ArchaealType 1 RNase H can cleave an RNA–DNA junction (a junction between the 3¢ side of RNA and 5¢ side of DNA) of an Okazaki fragment-like substrate (RNA9–DNAÆDNA), unlike other cellular...

Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx

... CTACTCACACTTGGCTTTACTpdesM GATTCATCCGTATCATAATAGTAAG TGGAACCTATGCCACCACTpdesN GTGAGAGCACTAACCAAGCTT CAATCAGTAGGCTTCGTCGTpdesO GATGAAGGCTGTTGGAAAG CATCATCCTCAATGCAACGGYeast expressionTpdesA GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG ... GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG GCGGAGCTCTCACGTGTACATGAAAGCTpdesB GCGGGTACCATGGCTCCACCCTCCATCAAAGAC GCGGAGCTCCTATCCCTGAGCACACATTpdesI GCGGGATCCACCATGGCTGGAAAAGGAGGAGAC GCGAATTCTTACATGGCAGGGAAATCTpdesK ... TGAATGTACAGATTGAACCTTpdesE GAGTTGATGAAGACATTGCG CTCCAACTGGTATTGCATTCTpdesG GATACTTCTTCATCTTGCACG CATATCTGAAGTGTGAGCGTpdesI GAGAATGCCAAGTTGGAG TGTTGCAACACTTCCACGGTpdesK GTGTGAGTTATGGAACGAAG CTACTCACACTTGGCTTTACTpdesM...

Xem thêm