Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt
Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt
... biomass pro-duction. Leaves accounted for over 50% ofNote Biomass production and stool mortality in hybrid poplar coppiced twice a yearD AuclairL Bouvarel1 INRA, Station ... dominants wereexpressed as means for each treatment. Theydid not include dead stools. Biomass data, ex-pressed on a land area basis, included all stools.RESULTS AND ... results clearly showed a decrease in biomass production and an increase in stool mortality in the biannual coppicingtreatment. In the absence of physiological studieson...
- 7
- 249
- 0
Tài liệu Báo cáo khoa học: "Balancing Clarity and Efficiency in Typed Feature Logic through Delaying" docx
... goal(farg(synsem,X,SynVal),farg(loc,SynVal,LocVal),farg(cat,LocVal,CatVal),farg(head,CatVal,HdVal),whentype(verb,HdVal,(farg(marking,CatVal,MkVal),whentype(fin,MkVal,(X=synsem:loc:cat:head:vform:bse))))).(6) ... Modularity: the cost in claritySemantic types and inheritance serve to organizethe constraints and overall structure of an HPSGgrammar. This is certainly a familiar, albeit vaguejustification ... when/2,are: (1) suspending until a variable is instantiated, and (2) suspending until two variables are equatedor inequated. The latter corresponds exactly tostructure-sharing in TFSs, and to shared...
- 8
- 449
- 0
Tài liệu Báo cáo khoa học: "Object clitics and clitic climbing in Italian HPS Ggrammar" docx
... lure, and I. Sag. Generalized Phrase Structure Grammar. Blackwell, 1985. [Hinrichs and Nakazawa, 1990] E. Hin- richs and T. Nakazawa. Subcategorization and VP Structure in German. In Hughes, ... [Pollard andSag, 1987] C. Pollard and I. Sag. Information-Based Syntax and Semantics. Funda- mentals., volume 1. CSLI, 1987. [Pollard and Sag, 1993] C. Pollard and I. Sag. Head- Driven Phrase ... shown that the approach can handle the relevant data concerning clitic climbing adequately and that it can account naturally for the fact that only certain verbs can trigger clitic climbing....
- 6
- 399
- 0
Báo cáo khoa học: Space, time and nitric oxide – neuronal nitric oxide synthase generates signal pulses pptx
... University and Veterans Affairs Medical Center, Durham, NC, USAIntroductionBiological signaling takes place across spatial and tem-poral regimes spanning many orders of magnitude, and has applications ... nNOS, 1 mm arginine,12 lm calmodulin and 100 lm CaCl2 in air-saturated BTPat pH 7.5 with 1 mm NADPH. Data collection and preliminary analysis of spectral stopped flow data wasperformed using olis ... Esc-herichia coli strain BL21DE, and purified using ammoniumsulfate precipitation and gel filtration and 2¢,5¢-ADP Sepha-rose chromatography [43,44]. Activity was measured by oxy-hemoglobin assay, and...
- 12
- 402
- 0
Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt
... blot using the rabbit a- Scpep1 antibody. A mixture ofmolecular mass standard proteins, including IgG (160 kDa), albumin(67 kDa), ovalbumin (43 kDa) and ribonuclease A (13.7 kDa), wasapplied ... intracellular processing into a mature dimerconsisting of a 35 kDa N-terminal fragment and a so far unknown 18 kDaC-terminal fragment and the glycosylation status of the mature Scpep1fragment. Although ... Biotechnology, Santa Cruz, CA,USA), a- Ctsa rat IgG2B (R&D Systems, Minneapolis, MN,USA), a- cathepsin D rabbit antiserum [35], a- Lamp1 ratIgG 2A (1D4B, Developmental Studies Hybridoma Bank,Iowa City,...
- 14
- 362
- 0
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... Statistical Learning: Data Mining, Inference and Prediction. Springer-Verlag, Berlin.297 Han J & Kamber M (2001) Data Mining: Concepts and Techniques. Morgan Kaufmann, San Francisco.298 Ananiadou ... Krallinger M, Andres E, Tamames J,Blaschke C & Valencia A (2005) Text mining for meta-bolic pathways, signaling cascades, and protein net-works. Sci STKE pe21.307 Vailaya A, Bluvas P, Kincaid ... multi-dimensional, and can be described or seen in variousways, including both wet (experimental) and dry (com-putational and theoretical), reductionist and synthetic,qualitative and quantitative, and a...
- 22
- 706
- 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf
... Ca2+paradoxParadoxical Ca2+increases were originally described in isolated heart preparations [195] and subsequentlyshown to be associated with tissue damage in this and other organs, including ... have alsoobserved the appearance of a nonselective, noninacti-vating cation conductance upon reducing extracellularCa2+ and Mg2+ in cultures of cortical neurons, as wellas in cortical and ... betweenexcitatory amino acid-induced increase in the intracel-lular Ca2+concentration and subsequent loss of neur-onal function in individual neocortical neurons in culture. Proc Natl Acad Sci USA...
- 18
- 549
- 0
Báo cáo khoa học: "Discourse Pragmatics and Ellipsis Resolution in Task-Oriented Natural Language Interfaces" pptx
... utterance. Taking advantage of the fact that a case frame analysis of a sentence or object description captures the meaningful semantic relations among its constituents in a canonical manner, a ... meaningless in the current domain. In these instances the semantic relations captured in a case frame representation and not in a semantic grammar parse tree prove immaterial. The key tO case-frame ... ascertain the most pressing needs of natural language interfaces in interactive apl~lications, The initial objective of this study was to circumscribe the natural language interface task by attempting...
- 5
- 417
- 0
Báo cáo khoa học: Characterization, localization and possible anti-inflammatory function of rat histone H4 mRNA variants potx
... AATAAAHN55CCACACCATCAGGCTGTGGATACATAGATAAGGCAACATGG95TATAAABH4g–66CGCCTGTGGTCTTCAATCAGGTCCGCAGAAGGTCTATTTAAA)25*CTTTTH4s–63TCCCTGCTGTTTTCAAACAGGTCCGCTCCCAGGAAATATAAGC)21*CTGTAH4-v.1)80CGCTCCCTGTTTTCACTCCGGTCCGCAAGTTCCATATAAGA)40*GAGCAHN)72CACTTGAAGTTCTCAACCAGGTCCGATAAGAGTGTATACTT-34*TGGAA a Underlined ... Sequence characteristics Poly (A) signalcCap site A H4g35GGCCCTTTTCAGGGCCACCCACGAACTCATTCAAAGGG72NoneH4s56GGCCCTTTTCAGGGCCCCCAAACTATCCAAAAGGAG91NoneH4-v.1 None AATAAAHN55CCACACCATCAGGCTGTGGATACATAGATAAGGCAACATGG95TATAAABH4g–66CGCCTGTGGTCTTCAATCAGGTCCGCAGAAGGTCTATTTAAA)25*CTTTTH4s–63TCCCTGCTGTTTTCAAACAGGTCCGCTCCCAGGAAATATAAGC)21*CTGTAH4-v.1)80CGCTCCCTGTTTTCACTCCGGTCCGCAAGTTCCATATAAGA)40*GAGCAHN)72CACTTGAAGTTCTCAACCAGGTCCGATAAGAGTGTATACTT-34*TGGAA a Underlined ... designedrat H4-v.1 (sense, 5¢-ggcggctaagaaacaaagtg-3¢; antisense,5¢-gaaaagttgggtggaagcaa-3¢) or rat HN (sense, 5¢-gccatggatgtggtctatact-3¢; antisense, 5¢-gccgaagccatagagagtg-3¢)primers and the QuantiTect...
- 14
- 429
- 0
Báo cáo khoa học: "Combining Deep and Shallow Approaches in Parsing German" pptx
... shallow approach based on machinelearning and a cascaded finite-state parserwith a hand-crafted grammar. It dis-cusses several ways to combine them and presents evaluation results for the two in- dividual ... Tony Rose, Amanda Clare, and AaronKotcheff. 2001. A natural language system for re-trieval of captioned images. Journal of Natural Lan-guage Engineering, 7(2):117–142.Haim Gaifman. 1965. Dependency ... guarantees interpretability and high precision and the latter provides robustness and high recall.This paper investigates such a combination consist-ing of an n-gram based shallow parser and...
- 8
- 417
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ