Báo cáo khoa học: "Morphological variability of oaks (Quercus robur L, Quercus petraea (Matt) Liebl, Quercus pubescens Willd) in northeastern France: preliminary results" pptx
Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf
... ª 2009 FEBS Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster Herve´Colinet1,2, Siu Fai Lee2 and Ary Hoffmann21 Unite´d’E´cologie ... processes involve expression of some Hsps in Drosophila [40,57]. Finally, it has been suggested that expression of Hsps during recovery from cold mightresult from the thermal stress experienced during ... mechanisms behind recovery from cold shock are complex, and it seems that more genes ⁄ proteins are activated during the recovery phasesthan during the actual period of the cold stress itself[16]....
- 12
- 388
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... ACAGCAAAAAGGAGGCCAAA 138BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 2 59 CD23 790 4 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707 095 ... 92 AL707 095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK 095 731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 1 09 DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT ... renal carcino-mas and, particularly, clear cell adenocarcinomas, cer-vical squamous carcinomas, ovarian carcinomas,colorectal carcinomas, esophageal carcinomas, bladdercarcinomas and non-small...
- 13
- 563
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
... series of experiments was conducted toinvestigate the possible in uences of pyridine nucleotides on the propaga-tion activities of hamster-adapted scrapie agents 263K and 139A in vitro using normal ... large amount of NADPH is oxidized during the long incubation time in PMCA, it also will be interesting to know whether there is a competitive rela-tionship between reduced pyridine nucleotide ... rPrP in PMCA is due to interaction withother unknown cellular components of the ScBH.This implies that reduced pyridine nucleotides mainlyact on the PrP molecules directly, because farthing of ScBH...
- 10
- 342
- 0
Báo cáo khoa học: Crystal structure of archaeal highly thermostable L-aspartate dehydrogenase/NAD/citrate ternary complex doc
... al. Crystal structure of L-aspDH from A. fulgidusFEBS Journal 274 (2007) 43154325 ê 2007 The Authors Journal compilation ª 2007 FEBS 4325 Crystal structure of archaeal highly thermostable L-aspartate ... 2007)doi:10.1111/j.1742-4658.2007.05961.xThe crystal structure of the highly thermostable l-aspartate dehydrogenase(l-aspDH; EC 1.4.1.21) from the hyperthermophilic archaeon Archaeoglo-bus fulgidus was determined in the presence of ... dimeric structure of A. fulgidus l-aspDH was refined ata resolution of 1.9 A˚with a crystallographic R-factor of 21.7% (Rfreeẳ22.6%). The structure indicates that each subunit consists of two...
- 11
- 323
- 0
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx
... TOC(0)(Beginning) Kanji, Hiragana, Number,Katakana, Alphabet (5:5)19 TOC(0)(End) Kanji, Hiragana, Number,Katakana, Alphabet (5:5)20 TOC(0)(Transition) Kanji→Hiragana,Number→Kanji,Katakana→Kanji, ... Morphological Analysis of a Large Spontaneous Speech Corpus in JapaneseKiyotaka Uchimoto†Chikashi Nobata†Atsushi Yamada†Satoshi Sekine‡Hitoshi Isahara††Communications Research Laboratory3-5, ... accuracy of automatic mor-phological analysis was lower than that of manualmorphological analysis. As previously stated, toimprove the accuracy of the whole corpus we take a semi-automatic approach....
- 10
- 398
- 0
Báo cáo khoa học: Structural analysis of the jacalin-related lectin MornigaM from the black mulberry (Morus nigra) in complex with mannose ppt
... 2 thatdelineate the carbohydrate-binding cavity of the lectin protomer). A closer examination of the structure of the binding sites indicates that specificity of the Mora-ceae lectins is primarily ... monosaccharide-bindingsite. (B) Network of hydrogen bonds (dashes) anchoring Man to the amino acid residues of the monosaccharide-binding site of MornigaM. Structure of a jacalin-related lectin complexed ... agglu-tinating activity of MornigaM is intimately linked toits sugar binding properties the three-dimensionalstructure of MornigaM in complex with a simple sugarwas determined to decipher the structural...
- 8
- 371
- 0
Báo cáo khoa học: Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types ppt
... 4383 Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types Doris Chiu, Kewei Ma, Alexander Scott and Vincent DuronioDepartment of Medicine, ... (1998) Involve-ment of guanosine triphosphatases and phospholipaseC-gamma2 in extracellular signal-regulated kinase, c-JunNH2-terminal kinase, and p38 mitogen-activated protein kinase activation ... result in protein kinase C(PKC) activation. While other tyrosine kinases mayalso be involved in ras activation downstream of theBCR, it is clear that activation of PLCc and PKC arealso intimately...
- 13
- 365
- 0
Báo cáo khoa học: "Morphological structure of accessory spleen in Chinese hamsters" pot
... structure of accessory spleen in Chinese hamstersYeo-Sung Yoon*, Jae-Won Shin1, Cheol-Beom Park, Yang-Seok Oh2, In- Se Lee, Heungshik S. Lee and Joon-Sup LeeCollege of Veterinary Medicine ... Center, College of Medicine, Hallym University, Chunchon 200-702, Korea To attempt a rigorous definition of the structure of the accessory spleen (AS) in the Chinese hamster, weexamined twenty-one ... Notably theincidence of AS appeared to increase with age in the Chinese hamsters. Key words: accessory spleen, chinese hamster, histologyIntroductionThere have been many reports on the incidence...
- 3
- 269
- 0
Báo cáo khoa học: "Genetic variability of the prion protein gene (PRNP) in wild ruminants from Italy and Scotland" ppsx
... The The PRNP gene in wild ruminants from Italy and Scotland 119Fig. 2. The phylogenetic tree of similarity among the PRNP gene sequences of the analysed wild ruminants and other wild and domesticungulates. ... mainland and 50 from the Isle of Rhum) and during the hunting seasons from Italy (n = 191). The chamois (n = 203) and roe deer (n = 189) all came from Italy and the sampling covered the whole Alpine ... (Fig. 1), 79 and 136. The red deer population from the Isle of Rhum was in HWE for all the polymorphisms, while the populations from mainland Scotland and from Italy were not in HWE for SNPs...
- 6
- 444
- 0
Báo cáo khoa học: "Genetic variability of a scattered temperate forest tree: Sorbus torminalis L. (Crantz)" ppsx
... among groups. For thecomparison between France and Central Europe, stan-dard errors of diversity parameters were based on thesampling of loci.Multivariate analyses (factorial analysis) based ... results of an investigation of the genetic variability of a scattered tree species, the wild service tree, Sorbus torminalis (L.) Crantz, based on an intensive sampling of populations inFrance. ... structure of populations of geographicallyrestricted and widespread species of Astragalus (Fabaceae),Amer. J. Bot. 75 (1988) 1114-1119.[16] Kremer A. , Zanetto A. , Geographical structure of genediversity...
- 9
- 252
- 0
Báo cáo khoa học: "Morphological variability of oaks (Quercus robur L, Quercus petraea (Matt) Liebl, Quercus pubescens Willd) in northeastern France: preliminary results" pptx
... PerringFH, eds). Bot Soc Br Isles, London, 27-50 Original articleMorphological variability of oaks (Quercus robur L, Quercus petraea (Matt) Liebl, Quercus pubescens Willd) ... Q petraea at a regional scale (Lor-raine Plain), including Q pubescens. Westudied inter- and intraspecific variations,and their link with ecological constraints. In this ... potentially interbreeding, themost widespread being Quercus robur and Quercus petraea. Until now, the prevalentopinion was in favor of the common occur-rence of hybrids...
- 6
- 175
- 0
Báo cáo khoa học: "The behavior of oaks in response to natural and induced exposure to the surfactant ABS" potx
... alt="" Original article The behavior of oaks in response to natural and induced exposure to the surfactant ABSS MoriccaE PaolettiC Comparini21Istituto di Patologia e ... could increase the tolerance of succeeding generations of trees by selecting for pollen grains thatare surfactant- tolerant. The alterations in the leaf waxes and in the pollen ... effect of the surfactant on the leaf wax structure. Though all species were affected, they dif-fered in their tolerance to ABS. The effect of ABS was also tested on the...
- 5
- 302
- 0
Báo cáo khoa học: "Morphological variability of oak stands (Quercus petraea and Quercus robur) in northern Germany" docx
... proportion of hybrid forms. RESULTS Of the investigated stands, 49% belongedto Q robur and 40% to Q petraea or con-sisted mainly of these species; 11 % of the stands were ... stand. Existing pedun-cles were also collected to test the result of thediscriminant analysis. Afterwards the stands were divided into the following classes:A) stands of ... thatleaves of stands with only minor charac-ters but no typical leaves of the other spe-cies have a certain number of hybrids. In figure 2, these stands are called...
- 5
- 237
- 0
Báo cáo khoa học: "Déterminisme de la surface des vaisseaux du bois des chênes indigènes (Quercus robur L, Quercus petraea Liebl). Effet individuel, effet de l’appareil foliaire, des conditions climatiques et de l’âge de l’arbre" potx
... indigènes (Quercus robur L, Quercus petraea Liebl). Effet individuel, effet de l’appareil foliaire, des conditions climatiques et de l’âge de l’arbreF HuberINRA, station de recherches ... est de 35% contre 60% dans le bois adulte. Effet de la largeur de cerne sur la surface des vaisseaux du bois initialL’étude de la corrélation entre la surface des vaisseaux ... l effet de l’âge cambial et de la largeur de cerne sur la taille des vaisseaux dans le bois juvénile et dans le bois adulte des mêmes arbres. De plus sur le bois adulte,nous...
- 16
- 616
- 0
Báo cáo khoa học: " Spatial variability of humus forms in some coastal forest ecosystems of British Columbia" pdf
... properties measured in the 3 Original article Spatial variability of humus forms in some coastal forest ecosystems of British ColumbiaH Qian,K Klinka Forest Sciences Department, ... ComputerApplications in Ore Evaluation. South African Institute of Mining and Metallurgy, JohannesburgLowe LE, Klinka K (1981) Forest humus in the Coastal Western Hemlock ... Indi-catorplants of coastal British Columbia. University of British Columbia Press, Vancouver, BC, CanadaKlinka K, Pojar J, Meidinger DV (1991) Revision of bio-geoclimatic units of coastal...
- 14
- 233
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ