Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot
Báo cáo sinh học: "The molecular epidemiology of Stenotrophomonas maltophilia bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004" pot
... on S. mal-tophilia from the UAE. However, S. maltophilia is an estab-lished pathogen in Tawam Hospital, which is a major tertiary referral hospital in the UAE. In a recent study of paediatric ... data included:age; clinical department; underlying disease; whether the infection was hospital- acquired; origin of bacteraemia; presence of a central venous catheter; whether the patientwas ... bacteraemia in a tertiary referral hospital in the United Arab Emirates 2000–2004Pauline A Jumaa*1,2,4, Agnes Sonnevend1, Tibor Pàl1,2, Mohammed El Hag1, Ray Amith1 and Omar Trad3Address:...
- 6
- 347
- 0
báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc
... facilitate the plan-ning and preparation of provincial and district trainingactivities, and guidance for quality assurance of trainingcourses. The training methodology included an ongoingassessment ... the training program.6. Inclusion of TB case management in pre-service training curricula The plan included activities to initiate the process toupdate curricula in national and private training ... provincial/district TB managementand training teams.4. Training of health service units (UPK).5. Training of hospital staff and private practitioners.6. Inclusion of TB case management in...
- 9
- 417
- 0
báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx
... developing the training. AVR conceived of the study, participated in developing the training, coordinated the study with FBand helped to draft the manuscript. All authors read andapproved the final ... consisting of a partici-pant's manual, a trainer's manual, Power Point® slides, a training evaluation questionnaire and the revised treat-ment card can be obtained from the correspondingauthor. ... HIV and TB care in this resource-poor setting. Involvement of the National TB and HIVProgram staff in the development phase facilitated the use of the training materials by the National Program...
- 9
- 650
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... anunderstanding of meaning in complex data through the development of summary themes or categories from the raw data" [26]. Data management was facilitated by the use of the MaxQDA qualitative data analysis ... to ensure that the quantity of data remainedat manageable levels. A point of data saturation wasquickly reached – the point at which the researcher feltthat increasing the number of respondents ... ourfriends there and we have now our friends here in Ire-land and then we'd be leaving them again" (Agatha,Philippines, 50 s).Career-related issues, such as the availability of salariessufficient...
- 12
- 495
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... formal demonstration in a clinical trial using clinical grade virus preparations.Evaluation of the two vaccine candidates revealed thatthey are reasonable candidates for further study in clinicaltrials. ... performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis. We also thank Brad ... 4, 6 and 8 post-challenge.d Mean sum of the daily virus titers: the sum of the titers for all of the days of sampling was determined for each animal individually, and the mean was calculated...
- 13
- 504
- 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... +10GCGGGTTCAAAAACTACTATAGGTAGGCAG DrosophilaTGCCTTATATGTTCGTCTGTAGGAGCGAGT ChickenGCATGTGCGGGCAGGAAGGTAGGGGAAGAC XenopusTATTGTACCTGGAGATATATGCTGACACGC RatTATTGGACCTGGAGATAGGTACTGACACGC MouseTTTGGGCCGCCGGGTTATATGCTGACACGC ... 1960(1851)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGcanus fam EcoRI BamHI (1809)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGpK9 ... bp)bla a IISV40pICaninepIICMVoritICGACCT CCGAAGTT GGGGGGGAG AGT CTT CT CGA GT AGAAG ACC GA CCT ACCT GGCAACAAAAAAT GTGCTGGAGGCTT CAACC CCC CCTCT CAGAAGAGCT CAT CT TC TGGCT GGATGGACCGTTGTTTTTTACAtIBbsI XhoI BbsIpIEvaluation...
- 12
- 567
- 0
Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot
... inhi-bition of intraoral inflammation [1,16]. Galectin-3 wasshown to specifically inhibit LPS-associated cytokineactivation, a characteristic of intraoral gram negativebacteria [16]. The potential ... dewaxed in grade dalcohol in preparation for immunohistochemical stain-ing. Immunohistochemical staining was performed with the alkaline phosphatase-anti-alkaline phosphatasemethod and an automated ... field.Statistical analysis In order to analyze cytoplasmic immunohistochemicalstaining and the spatial pattern of expression, the label-ing index was determined as the number of positivelystained...
- 11
- 416
- 0
Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx
... provided in trans. This extended hairpin, capable of acting as an origin of replication, lacks the arrangement of the specific domains present in the dimer duplex intermediate of MVM, the only active ... Lt-Lt/pGlu∆Xba and, LuIII Lt-Lt/pCMVNS1, contrib-uted in the analysis and interpretation of the data, partic-ipated in the design of the models proposed and in the drafting and revision of the manuscript.All ... 3'minimal origin and leaving NS1 covalently attached to the 5' end of the DNA at the nick site [16,17]. The regioncontaining the PIF binding site is highly conserved in the 3' hairpin of...
- 11
- 678
- 0
Báo cáo sinh học: " Research Article Solutions of Linear Impulsive Differential Systems Bounded on the Entire Real Axis" ppt
... Entire Real AxisAlexandr Boichuk, Martina Langerov´ a, and JaroslavaˇSkor´ıkov´ a Department of Mathematics, Faculty of Science, University of ˇZilina, 010 26ˇZilina, SlovakiaCorrespondence ... Russia, 1971.4ˇS. Schwabik, M. Tvrdy, and O. Vejvoda, Differential and Integral Equations, Boundary Value Problems andAdjoints, Academia, Prague, 1979.5 A. A. Boichuk and A. M. Samoilenko, ... exponentially dichotomous on the semiaxesR−and Rand by using the theory of pseudoinverse matrices, we establish necessary and sufficient conditions for the indicated problem. The research in the theory...
- 10
- 295
- 0
Báo cáo sinh học: " Research Article Development of the Database for Environmental Sound Research and Application " pot
... “N /A .Rhythmically and Temporally Related Variables(1) Amplitude slope (reflects the initial attack and decay of a sound).(2) Autocorrelation peaks (indicating the degree andperiod of the ... originator will have the option to removeone of their sounds from the database.8.4. Database. Participants can add or edit audio data onsounds they originate and can make ratings on other soundsfor ... tosounds in the world. The database will be organized around the sources of sounds in the world and will include a widevariety of acoustic, contextual, semantic, and behavioral dataabout the sounds,...
- 12
- 352
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP