Báo cáo khoa học: "Genetic variability of a scattered temperate forest tree: Sorbus torminalis L (Crantz)" ppsx

Báo cáo khoa học: "Genetic variability of a scattered temperate forest tree: Sorbus torminalis L. (Crantz)" ppsx

... et al.6411, 32]. Similarly, allozyme surveys have shown thatgeographically restricted species that are locally abun-dant contain fewer polymorphic loci and a lower meannumber of alleles ... north of France (group 1). In addition, allele b of AAP was absentin group 5 and allele b of SKDH was absent from group 1. The mean number of alleles per group (table III) varied very little: ... Slovakia (3 populations), Slovenia,Bulgaria, and Switzerland (one population each) (table I). A population sample consists of dormant budsfrom at least 11 mature trees or young stems separatedfrom...

Báo cáo khoa học: "Genetic variability of the prion protein gene (PRNP) in wild ruminants from Italy and Scotland" ppsx

... deer samples from Scotland were 19fwd (5’ ATT TTG CAG ATA AGT CAT C 3’), 778rev (5’ AGA AGA TAA TGA AAA CAG GAA G 3’) and 315fwd (5’ CAG TAA ACC AAA AAC CAA C 3’). A detailed description of ... Simone Peletto et al.Tabl e 2 . Allele frequencies of the PRNP polymorphisms in red deer from Italy and ScotlandAllele frequency (%)Cervus Cervus Codon Alleleelaphus elaphus elaphus scoticus ... distance value was between the red deer from Italy and mainland Scotland (0.089). The distance value between the Italian and Isle of Rhum deer was 0.078 and that between Mainland Scotland and...

Báo cáo khoa hoc:"Genetic parameters of a random regression model for daily feed intake of performance tested French Landrace and Large White growing pigs" pptx

... weekly means of daily feed intake are slightlylower than the values found by Von Felde et al. [25]. Heritability estimates of Hall et al. [11] for four biweekly means of daily feed intake lay ... sequence relativeto coupled chains. For all graphical analysis of Gibbs chains the statisticalsoftware package S-Plus [18] was used.Effective sample size [23] of samples after burn-in was estimated ... intake (kg) for males and castrates of Large White (left panel) and French Landrace (right panel) growing pigs estimatedwith models 1 and 2, as well as from data of each test week separately.got...

Báo cáo khoa hoc:"Genetic parameters of a random regression model for daily feed intake of performance tested French Landrace and Large White growing pigs" ppsx

...

Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

... of an L- and an Oh-layer. The Of- layer has become tangled and lami-nated. The pH has decreased by half a unit. The translocation of fulvic acids has increased and ... acidification.MATERIALS AND METHODS A loamy Orthic Luvisol (Typische Parabrau-nerde, Typic Hapludalf, Sol brun lessivé) formedin the Weichselian boulder marl over fluviogla-cial ... is almost com-pletely decomposed and humified; Oribati-dae faeces, an increased amounts of En-chytraeidae faeces and small amounts of worm faeces are also present.Ah 1...

Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx

... individualj of genotype or family i, μ is the overallOriginal articleGenetic determination of vessel area in oak(Quercus robur L and Q petraea Liebl): a characteristic ... material collectedfrom a half-sib progeny trial, also located inBramwald Forest near Kassel in Lower Saxony,Germany. The experiment, established in 1950,consisted of ... have vessels of smaller cross-sectional areas than lateflushing ones. In oak, new vessels areformed about 1 week after buds break. In-dole-3-acetic acid (IAA) is believed...

Báo cáo khoa hoc:" Genetic components of litter size variability in sheep" potx

... of litter size variability in sheepMagali SANCRISTOBAL-GAUDY a, ∗,LoysBODINb,Jean-Michel ELSENb, Claude CHEVALET a aLaboratoire de génétique cellulaire, Institut national de la ... approach was compared with moretraditional methods.2. GENETIC MODEL2.1. Threshold model for polytomous data – Likelihood approachAsGianolaand Foulley[10], Foulley andGianola [8]orSanCristobal-Gaudyet ... environmental variability asis usually done for the mean. The year, herd, season and age have no signiﬁcanteffects on the variability of litter size in the Lacaune population, but the sirefactor has...

báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf

... CACGAATGTGAATTTGATCGReverse CGACCAAGGAGATAAAAACAGAKSC138-17 Forward TGGAAATTCTGTGCACTTGGTGReverse TAAAGCCGCCTAGCCGATTGKSC138-22 Forward TGCAGCAATAATCAATCAAATAGAAReverse TTCAATCAAATTTAGCACGTGTATTKSC138-23 ... Forward CTGGAGGCAGAGTATAGCGReverse AAACTCCCAGGTCCCACCCAATg-TMT2 Forward GAAGCAAGTTTCCAACAGGTCGReverse CGCCAATCATAGGAGATATTGCATATGg-TMT3 Forward CAGTGGACTTAAAACCATAAAGGGAGCReverse CCACATACTCTATATCATTCACACGAG18S ... | | | | |Williams82 ATTAGTTAAA ACACCTATGC TGACAGGATA GTAAACCAAT ACAAGACGTG TCTATAAAAA GTTAACATGAIchihime Toyokomachi KAS A Dobrogeance A Pancevo A CAAT box TATA box-12-81-45䊶䊶䊶䊶䊶䊶Figure...

báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps

... to attack malignant cells (or any other types of abnormal cells) that escape the body’s natural surveillance by using T cells that have a natural or genetically engineered reactivity to a patient’s ... enhancing the persistence of transferred T cells include ablation of all white blood cells (myeloablative methods), such as total body irradiation and administration of toxic levels of interleukin ... advantages of such biomodular platforms to a broader range of applications. ey were able to do so by the reliable de novo construction of modular, portable and scalable control systems that can achieve...

báo cáo khoa học: " Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid" docx

... BrazilEmail: Daniel Foncéka - daniel.fonceka@cirad.fr; Tossim Hodo-Abalo - aristossim@yahoo.fr; Ronan Rivallan - ronan.rivallan@cirad.fr; Issa Faye - issafaye2001@yahoo.fr; Mbaye Ndoye Sall - ... (A. duranen-sis V14167 diploid AA and A. ipaënsis KG30076 diploidBB), a tetraploid AABB amphidiploid (A. ipaënsis × A. duranensis)4X, hereafter called AiAd and a cultivated tetra-ploid AABB ... previously reported based onmolecular makers and on GISH. The construction of a consensus molecular genetic map involving the availablediploid AA and BB maps and the tetraploid AABB maps aswell as...

Xem thêm