0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Comparative studies of the water relations and the hydraulic characteristics in Fraxinus excelsior, Acer pseudoplatanus and A opalus trees under soil water contrasted conditions Damien Lemoinea, Jean-Paul Peltierb and Gérard" pdf

Báo cáo khoa học:

Báo cáo khoa học: "Comparative studies of the water relations and the hydraulic characteristics in Fraxinus excelsior, Acer pseudoplatanus and A. opalus trees under soil water contrasted conditions Damien Lemoinea, Jean-Paul Peltierb and Gérard" pdf

... the same variations.Original articleComparative studies of the water relations and the hydraulic characteristics in Fraxinus excelsior, Acer pseudoplatanus and A. opalus trees under soil water ... free water ap-pears at the stomata level. The leaf was then fixed on a plate of an analytical balance and the water flow was in- duced by forcing distilled water through the leaf with a pressure ... two individual trees of each population. Errors bars represent one standard deviation(n = 6–8). water availability to the trees. Under these conditions, the leaves of ash and Acer pseudoplatanus...
  • 10
  • 341
  • 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

... towards dsDNA, ssDNA and plasmidwere analyzed using linearized pBAD ⁄ gIII plasmid, linea-rized and denatured plasmid and intact plasmid. The pBAD ⁄ gIII plasmid was linearized using SalI and ... on cold adaptation is in manycases based on marine secreted enzymes. Detailed dataon salt adaptation of marine cold-adapted secretedenzymes is lacking and may be a source of error in the conclusions ... replicate is plotted and the mean values are drawn.ABFig. 8. Cleavage of plasmid, dsDNA and ssDNA. (A) 14 nM VcEndAincubated at 23 °C for 5 min with plasmid (lane 2), dsDNA (lane 4) and ssDNA...
  • 12
  • 565
  • 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... streng-thening of the interaction between the structural TnC-binding site and the C-domain of TnC accompanyingCa2+binding to site IV of TnC. In vertebrate tropo-nin, the activation may be a result ... actomyosin-tropo-myosin Mg-ATPase by rabbit (A and C) and Akazara scallop (B and D) reconstituted tropo-nins. The effects of the troponin containingTnI or TnI fragments on the actomyosin-tropomyosin Mg-ATPase ... of both TnC and Ca2+; lanes b and e, in the presence of TnC and the absence of Ca2+; lanes c and f, in the presence of bothTnC and Ca2+. Ac, actin; Tm, tropomyosin; RTnC, rabbit TnC; ATnC,...
  • 12
  • 514
  • 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence ... Y70W-fwd:5¢-CTGCTGGAGCTGATGTGGAAAGATCCCAAGAAG-3¢. Y70W-rev :5¢-CTTCTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢. Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. ... is saturating in ourexperiments, when evaluating the impact of the muta-tions from the kinetic data, a change in the Kmvaluecan be interpreted as an effect on substrate binding, and a change...
  • 10
  • 504
  • 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

... available, indicating secondary struc-tural changes in the linker connecting the dimerization and DNA-binding domains, and rearrangement of the relative orientation of the two domains [7,9]. The ... 1A) , indicating that the secondarystructure is not affected by the mutation or byAEDANS labeling. Thermal denaturation analysis of the protein variants suggests a lower stability of the mutant ... with the half site alsopresent in the operator in bold).Name Length (bp) Sequence1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT1DR 45 ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC1DR-short...
  • 15
  • 431
  • 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

... methods of PCR analysis and cloning were as described above.Quantitative real-time RT-PCR The cRNA standards of quantitative RT-PCR, includingPO-CHH and ES-CHH, AK and eIF 4A, were initiallyPCR amplified ... oxygen in seawater, suggestingan adaptive role. A single SG in the ES of Cal. sapidus contains twoisoforms of CHH. The molecular mass difference sug-gests that the major CHH may have pyroglutamate ... (http://www.dnr.state.md.us/bay/monitoring /water/ index.html). In particular, it is notedthat in the Bay, low temperatures during winter and anoxia during summer, in combination with the changes in salinity,...
  • 12
  • 474
  • 0
Báo cáo khoa học: Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions docx

Báo cáo khoa học: Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions docx

... for Marine Biosciences,National Research Council of Canada, Halifax, CanadaAeromonas salmonicida is a pathogenic aquatic bacterium and t he causal agent of furunculosis in salmon. In the course of ... trisac-charide repeating unit) and m/z 663.2 Da (GalNAcA-containing trisaccharide repeating unit) (Fig. 4A, inset),based on this ratio about 40% of G alNAcA in both CPS and O-chain p olysaccharides ... GalNAcA i s partly presentedas an amide and AlaNAc represents N-acetyl-L-alanylgroup. CE-ES-MS analysis of CPS and O-chain polysac-charide confirmed that 40% of GalNAcA was presen t in the amide...
  • 10
  • 332
  • 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... polyclonal anti- (a- tubulin) and Alexa Fluor 647-conjugated goat anti-(rabbit IgG) in the case of anti-myc and anti- (a- tubulin) double labeling, or with anti- (a- tubulin) mAb and Alexa Fluor 546-conjugated ... FEBSExpression studies of the core+1 protein of the hepatitis Cvirus 1a in mammalian cells The in uence of the core protein and proteasomes on the intracellular levels of core+1Niki Vassilaki, Haralabia ... CCTAAACCTCAAAAAAAAACAAACGTAACACC N246–N247 59N247 (antisense) GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGGN298 (sense) CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG N298–N300 57N300 (antisense) GGAATTCCAGCGGTTTAAACTCAATGN222...
  • 18
  • 365
  • 0
Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf

Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf

... glycopeptide-containing fractions are indicated.Ó FEBS 2003 N-glycosylation of maize and tobacco lactoferrin (Eur. J. Biochem. 270) 3237 of the antennae, and the presence of a bisectingb1,2-xylose, and of an ... example, coexpression of human b1,4-galactosyltransferase and heavy and light chains of mouseantibody results in the synthesis in tobacco plants, of a recombinant antibody that exhibits 30% of ... recombinant therapeutic glycoproteins of mammalian origin in transgenic plants, and efforts areunderway to obtain the in planta conversion of N-glycansto a human-compatible type. Recently, tobacco...
  • 8
  • 426
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparative study of endocrine cells in the principal pancreatic islets of two teleosts, Silurus asotus (Siluridae) and Siniperca scherzeri (Centropomidae)" potx

... secretion of the gastrin,cholecystokinin, secretin, glucagon, insulin, motilin and gastric acid (Kitamura et al., 1984) and the absorption of amino acid, glucose and fatty acid in the gastrointestinaltract ... againstmammalian insulin, glucagon, somatostatin and PP, in the pancreas of teleosts, localization of endocrine cells in the principal pancreas of Silurus asotus and Sinipercascherzeri have not ... Immunohistochemicallocalization of somatostatin, insulin and glucagon in the principal islets of the anglerfish (Lophius americanus) and the channel catfish (Ictalurus punctata). Am. J. Anat. 1976,147,...
  • 6
  • 395
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ