Báo cáo khoa học: "An atypical case of respiratory actinobacillosis in a cow" pot

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGCC3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K ... (5Â3Â)MA(9)ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X ... 3 and 6 on protein N-myristoylation, sequential vertical-scanning mutagenesis of the amino acids at positions 3 and 6 in a model substrate protein having a sequence MGAAAAAAAA at itsN-terminus...

Báo cáo khoa học: "An Empirical Evaluation of Probabilistic Lexicalized Tree Insertion Grammars*" potx

... LTIGs) are tree- rewriting sys- tems, consisting of a set of elementary trees combined by tree operations. We distinguish two types of trees in the set of elementary trees: the initial trees and ... An empirical evaluation of probabilistic lexicalized tree insertion grammars. Technical Report 06-98, Harvard Uni- versity. Full Version. K. Lari and S.J. Young. 1990. The estima- tion of ... the results of two empirical experiments using Probabilis- tic Lexicalized Tree Insertion Grammars. Com- paring PLTIGs with PCFGs and N-grams, our studies show that a lexicalized tree represen-...

Báo cáo khoa học: "An Error Analysis of Relation Extraction in Social Media Documents" ppt

... Domain International AAAI Conference onWeblogs and Social Media Data Challenge Workshop.2010.Klein D. and Manning C. Accurate Unlexicalized Pars-ing. Proceedings of the 41st Meeting of the ... Computational LinguisticsAn Error Analysis of Relation Extraction in Social Media DocumentsGregory Ichneumon BrownUniversity of Colorado at BoulderBoulder, Coloradobrowngp@colorado.eduAbstract Relation ... cause of the re-duction in relation extraction performance. There isalso some evidence that because of the greater num-ber of relations in the JPDA authored documents thatthe classiﬁer training...

Báo cáo khoa học: "Successful surgical correction of anal atresia in a transgenic cloned piglet" doc

... ...

Báo cáo khoa học: "An atypical case of respiratory actinobacillosis in a cow" pot

... and pathological findings, and the surgical treatment of a case of atypical actinobacillosis in a cow. A 4-year-old female Jersey bovine who was not pregnant, and had been born and raised at ... giuliano.bettini@unibo.itAn atypical case of respiratory actinobacillosis in a cowPeli Angelo1, Spadari Alessandro1, Romagnoli Noemi1, Bettini Giuliano2,*, Scarpa Filippo2, Pietra Marco1Departments ... the Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, University of Bologna, was examined following the sudden appearance of respiratory noise, nasal discharge and...

báo cáo khoa học: "An operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue" ppt

... et al.: An operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue.World Journal of Surgical ... of Surgical Oncology 2011, 9:3http://www.wjso.com/content/9/1/3Page 8 of 8 CAS E REP O R T Open AccessAn operative case of hepatic pseudolymphoma difficult to differentiate from primary hepatic marginal ... Kazuhiro Yamamoto5, Hironori Haga6, Takayuki Takubo2, Nobuhiko Tanigawa1Abstract Hepatic pseudolymphoma (HPL) and primary hepatic marginal zone B cell lymphoma of mucosa-associated lymphoid...

báo cáo khoa học: "Littoral cell angioma of the spleen in a patient with previous pulmonary sarcoidosis: a TNF-α related pathogenesis?" pot

... Littoral cell angioma of the spleen in a patient with hepatocellular carcinoma. J Formos Med Assoc2005, 104:282-285.15. Ercin C, Gurbuz Y, Hacihanefioglu A, Turgut Karakaya A: Multiple littoral cell angioma ... Bisceglia M, Sickel JZ, Giangaspero F, Gomes V, Amini M, Michal M: Littoral cell angioma of the spleen: an additional report of four cases with emphasis on the association with visceral organ cancers. ... N, et al: Littoral cell angioma of the spleen: appearance on sonography and CT. J Clini Ultrasound 2002, 30:510-513.7. Levy AD, Abbott RM, Abbondanzo SL: Littoral cell angioma of the spleen: CT...

Báo cáo khoa học: "An unusual case of low-grade tubulopapillary adenocarcinoma of the sinonasal tract" doc

... not for citation purposes)World Journal of Surgical OncologyOpen Access Case reportAn unusual case of low-grade tubulopapillary adenocarcinoma of the sinonasal tractAshish Bansal*1, Keloth ... Subse-quently, the patient had two further operations. Firstly,removal of the posterior aspect of the nasal septum wasperformed four months after removal of this mass. Sec-ondly, a biopsy of the nostril ... absence of thyroid or pulmonary primary in the present case remains an enigma. However, this raises the possibility of the utility of this antibody to predicta better clinical outcome in the subset...

Báo cáo khoa học: "Multi-visceral resection of pancreatic VIPoma in a patient with sinistral portal hypertension" docx

... CentralPage 1 of 6(page number not for citation purposes)World Journal of Surgical OncologyOpen AccessCase reportMulti-visceral resection of pancreatic VIPoma in a patient with sinistral portal ... literature.Aggressive resection of patients with advanced VIPoma neuroendocrine tumors has rarely beenreported.Case presentation: A 46 year old women presented with abdominal pain and diarrhea. ... beexceptionally large with invasion of adjacent visceral andvascular structures. As such, accurate preoperative imagingis critical. In particular, assessment of the relationshipbetween the tumor and...

Báo cáo khoa học: "An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" docx

... < 0.025) in comparison to the non-irradiated skin thickness investigating chronic skin reactions. Patients with grade 2 acute skin toxicity presented with thinner skin as compared to patients ... al. Radiation Oncology 2011, 6:9http://www.ro-journal.com/content/6/1/9Page 3 of 10 RESEARCH Open AccessAn ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation ... 49:713-721.doi:10.1186/1748-717X-6-9Cite this article as: Wong et al.: An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy. Radiation Oncology 2011 6:9.Submit your...

Báo cáo khoa học: " An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" pptx

...

báo cáo khoa học: "An unusual case of suprascapular nerve neuropathy: a case report" pptx

... the suprascapular or spinoglenoid notch. Wepresent a puzzling case of a man with suprascapular nerve neuropathy that may have been associated with anappendectomy. The case was attributed to nerve ... CAS E REP O R T Open AccessAn unusual case of suprascapular nerve neuropathy: a case reportCharalambos P Economides1,2, Loizos Christodoulou3, Theodoros Kyriakides4and Elpidoforos ... malformations, and,most fr equently, injuries related to sports act ivities [3].We present a case of a 23-year-old Caucasian man whodeveloped suprascapular nerve neuropathy that mayhave been associated...

báo cáo khoa học: " Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report" doc

... this article as: Fouad: Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report. Journal of Medical Case Reports2011 5:43.Submit your next manuscript to BioMed Centraland ... invasion.Discussion Paget’s disease is an eczematous skin change of the nip-ple that is usually associated with an underlying breast malignancy [1]. It may present with erythema, scaling,ulceration, bleeding or a painful ... Histopathology confirmedPaget’sdiseaseoftherightnipplewithnoevidenceofunderlying invasive ductal carcinoma, ductal carcinoma in situ of the breast tissue or lymph node invasion.DiscussionPaget’s...

3
1,053
0

báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx

... CAS E REP O R T Open Access Typical carcinoid tumor of the larynx in a woman: a case reportFatma Tülin Kayhan*, Efser Gürer BaşaranAbstractIntroduction: Neuroendocrine tumors are the ... this article as: Kayhan and Başaran: Typical carcinoid tumor of the larynx in a woman: a case report. Journal of Medical Case Reports 20104:321.Submit your next manuscript to BioMed Centraland ... English language literature todate [4]. We pres ent an unusual case of typica l carcinoid tumor of the larynx in a woman, and review the literatureon neuroendocrine neoplasms of the larynx. Case...

báo cáo khoa học: "Squamous cell carcinoma of rectum presenting in a man: a case report" potx

... cell carcinoma 11 years after brachytherapy for carcinoma of the prostate. JUrol 2003, 169:280.20. Jaworski RC, Biankin SA, Baird PJ: Squamous cell carcinoma in situ arising in inflammatory cloacogenic ... cell carcinoma of the rectum in the ethnic Kashmiri population in northern India. Case Presentation: The case of a 60-year-old male patient (Asian) with a pure squamous cell carcinoma of the rectum ... 55:273-276.29. Birnbaum W: Squamous cell carcinoma and adenoacanthoma of thecolon. JAMA 1970, 212:1511-1513.Table 1 Reported cases of squamous cell carcinoma of the colorectum (Data available from 1933...

Xem thêm