Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

... The pandas in this case study did not respond to anti-bacterial or anti-fungal therapy. However, the clinical Isolation and identification of a canine coronavirus strain from giant pandas 263Fig. ... reports of CCV infection in pandas. In this study, we isolated a strain of CCV from two giant pandas, which suggests that pandas can be infected with CCV. To isolate the virus, two inoculation ... potential viral pathogen was pursued. Canine coronavirus was first isolated from a case of canine enteritis during an epizootic in Germany in 1971. Later, Woods and Wesley [9] reported that CCV...

Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

... CCTGTCAACTGAGCAGCACTTTGeae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14]eae A- R CCCCATTCTTTTTCACCGTCGhly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14]hly A- R CTTCACGTGACCATACATATH7-F ... P010726-25, and O157-C-1-2), and 14 USAisolates; 4 strains of ATCC (A1 , A2 , A3 , and A4 ), 6 strains of Cornell University (C1, C2, C3, C4, C5, and C6), and 4strains of Pennsylvania State University ... C, da Silveira WD, da Silva Correa S, Nakazato G,Bando SY, Ribeiro MA, Pestana de Castro AF.Microbiological comparative study of isolates of Edwardsiella tarda in different countries from...

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Nagasawa T, Ohkishi H, Kawakami B, Yamano H,Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala-nine chloride-lyase (deaminating) of Pseudomonas putidaCR 1–1. Puriﬁcation and characterization ... Isolation and characterization of a D-cysteinedesulfhydrase protein from Arabidopsis thalianaAnja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and Jutta PapenbrockInstitute for Botany, ... ground wasused for the analyses. (A) Total RNA was extracted and 20 lg RNAwas loaded in each lane and blotted as indicated in Experimentalprocedures. To prove equal loading of the extracted RNA...

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF9 of A. thaliana.These proteins b elong to the 2Cys-Prx subfamily. A ll plan t2Cys-Prx proteins, except BAS1 of barley, ... were separated by HPLC and some of themwere totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2).Computer database searches based on the amino-acidsequences ... Storz, G. &Rhee, S.G. (1994) Cloning and sequencing of thiol-speci®cantioxidant from m ammalian brain: alkyl reductases and thiol-speci®c antioxidant de®ne a large family o f antioxidant enzymes.Proc....

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereasagglutination was inhibited by galactose and its deriva-tives [such as N-acetylgalactosamine (GalNAc),methyl -a- d-galactopyranoside], it was evident that, atdoses ... R, Maiti TK & Podder SK (1991) Puriﬁcation and characterisation of three toxins and two agglutinins from Abrus precatorius seed by using lactamyl-Sepharoseafﬁnity chromatography. Anal Biochem...

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain speciﬁc for the human mitochondrial translocase receptor Tom70 potx

... (Forward: 5¢-ACAAGGGTAGACCAAACACCAAGAACAGCAACAAAAGAGACGGGCGAATCACTGACCATCAACgccGTCCTGAGAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAATGCGGTGCCAGCTCCCCAACTGTAATAAATACCAGACAAATTATATGCTCCaacCCTATACGTGCCACTG-3¢); ... linker and dual FLAG octa-peptide tags). Approximate elution times for a series of proteinstandards are indicated by arrows, and the absorbance at A 214(unbroken line) and A 280(dashed line) ... retention of binding afﬁnity.Material and methodsEquipment and reagentsRestriction enzymes and Vent DNA polymerase werepurchased from New England Biolabs; T4 DNA ligasewas from Biotech (Australia)....

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... anessential component of the TGF-b signaling pathway. In thisstudy, we describe the isolation of Xenopus HIVEP1,aswellas partial cDNAs of HIVEP2 and -3. Analysis of the tem-poral and spatial expression ... HIVEP1,hasalso been isolated and characterized [14–16].Typically, the large zinc ﬁnger (Znf) DNA bindingproteins have a molecular mass greater than 250 kDa and contain two ZAS domains (N and C) ... late gastrula and neurula stages (stages 11–20), expression decreases temporarily and increases again atstage 24. In adult tissue, XHIVEP transcripts were detectedat comparable levels in all...

Báo cáo khoa học: " Isolation and characterization of Streptococcus sp.from diseased flounder (Paralichthys olivaceus )in Jeju Island" ppt

... ...

Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps

... 5´-AAGGGTAGGACGCTCCGTAT-3´), collagen 1A1 (COL 1A1 ) (sense, 5´-CACCTCAGGAGAAGGCTC AC-3´; antisense, 5´-ATGTTCTCGATCTGCTGGCT-3´), osteonectin (SPARC) (sense, 5´-TGAGAAGGTATGCAG CAACG; antisense, 5´-AGTCCAGGTGGAGTTTGTGG), ... mesenchymal stem cells have immunomodulatory capacities. Stem Cells Dev 2007, 16, 597-604.14. Igura K, Zhang X, Takahashi K, Mitsuru A, Yamaguchi S, Takashi TA. Isolation and characterization of ... 5´-AGTCCAGGTGGAGTTTGTGG), vitamin D receptor (VDR) (sense, 5´-CCAATCTGGATCTG AGGGAA; antisense, 5´-TTCAGCAGCACAATCTGGTC- 3´), and osteoclacin (BGLAP) (sense, 5´-GTGGTGCAAC CTTCGTGTC; antisense, 5´-GCTCGCATACTTCCCTCTT...

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... GTT GGA ATT CCA TCA TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAGGAG GGA TAT GGG GAA C. The PCR reaction wasdone as described above. The ampliﬁed ... T. reesei DNAwith the following primers: forward, GGG GAC AAGTTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGTCAG GTC CCT CTC G; and reverse, GGG GAC CACTTT GTA CAA GAA AGC TGG GTC A GT GGT GGTGGT ... oxidase, Japanese patent 61115488.37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent60062980.38 Abdel-Raheem A & Shearer CA (2002)...

Xem thêm