Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebraﬁsh pptx

... transcripts are found in the organizer of gastrula embryos, later in the prechordal plate andaxial mesoderm (Fig. 2). By contrast, noggin2 tran-scripts are detected at the end of gastrulation in the axial ... othermembers of the TGF-b family, binding to and inhibit-ing these signaling molecules from binding to theirreceptors in the extracellular space, thus inhibiting ven-tralizing activities. Of these ... interaction with Smad4 couldaccount for the sbn mutant phenotype. In addition, the loss of smad5 activity might lead to the inhibition of other Smads, such as Smad1, involved in the Smad signaling...

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

... incubation with a rabbit serum raised against HNE–protein adducts. Ligand-binding tests showing the functionality of the same HNE-treated porcine (B) and bovine (C) OBPs as in the immunostaining. ... was ﬁnally calculated by sub-tracting the values determined in the ultraﬁltrates from the initial amounts of HNE. The second aliquot of each samplethat had been stored at 4 °C was than treated ... lachrymal and lingual salivary glands, and has beenfound to be expressed by several other secretory tissuessuch as prostate, mucosal glands of the tracheobronchi-al tree, nasal mucosa and sweat glands...

Báo cáo khoa học: "Malignant ocular melanoma in a dog" pptx

... ...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 ... iron-dependent.Characterization of the kinetic parameters of the enzymatic activity of zebraﬁsh RPE65cTo determine the steady-state kinetics of the enzymaticactivity of zebraﬁsh RPE65c, the assay conditions...

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... expression in female hearts indicates thatmyocardial glucose metabolism may be increased in parallel. As optimization of glucose metabolism isincreasingly highlighted as a therapeutic interventionfor ... effects via the prosurvival serine-threonineprotein kinase, Akt (also known as protein kinase B)[2]. In agreement with this, elevated levels of activatedAkt in female hearts are linked to improved ... microliters of supernatantwas added to 175 lL of distilled water and 25 lL of ATPassay mix [Bioluminescent Somatic Cell Assay Kit (FL-AA);Sigma, St Louis, MO] containing luciferin and luciferase.The...

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... howosmosensing and osmosignaling integrate into the overall context of growthfactor signaling and the execution of apoptotic programs.AbbreviationsEGF, epidermal growth factor; MAPK, mitogen-activated ... hydration as the primary factor in carcinogenesis: a unifying concept. Med Hypotheses66, 518–526.25 Maeno E, IshizakiY, Kanaseki T, Hazama A &OkadaY (2000) Normotonic cell shrinkage because ... of autophagic proteolysis [14]. Thus, integrin-dependentcell volume sensing and signaling integrates into the overall context of insulin signaling. Similarly, sensing of glutamine-induced hepatocyte...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... (glutamate oraspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. woodii hasonly 10 membrane-buried negative charges that areessential for binding ... binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive ... The C-terminal helices show a clear handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same patternas in the AFM surface representation of Fig....

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... Osanai K, Takahashi K, Nakamura K, Takahashi M,Ishigaki M, Sakuma T, Toga H, Suzuki T & VoelkerDR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... with the yeast mitochondrial outer mem-brane in yeast is integral in the membrane and most of the integral outer membrane proteins behave as if theyhave a- helical transmembrane segments, partitioninginto ... material (P). Proteins were then analyzed by immunoblotting afterSDS ⁄ PAGE using antisera against the matrix-located mtHsp70, the membrane protein porin and GFP.Integral proteins in the mitochondrial...

Tài liệu Báo cáo khoa học: "Automatic error detection in the Japanese learners’ English spoken data" pdf

... ,,∑∑∑∈∈∈∈∈∈−=≤≤∀=BbAajBbAaBbAajjbapbappHkjfforbagbapbagbap We assumed that the constraint of feature sets fi (i≦j≦k) was defined by Eq. 1. This is where A is a set of categories and B is a set of ... “Standard Speaking Test (SST)”. The SST is a face-to-face interview between an examiner and the test-taker. In most cases, the examiner is a native speaker of Japanese who is officially certified ... provides a great deal of useful information on the construction of a model for the developmental stages of Japanese learners’ speaking abilities. In the support system for language learning,...

Tài liệu Báo cáo khoa học: "Reactive Content Selection in the Generation of Real-time Soccer Commentary" pdf

... manually annotated each statement in the Japanese output for the RoboCup'9? quater-final with it optimal time for utterance. We then calculated the average delay in the appearance of these ... that intuitively capture the amount of information communicated to the audience. We describe how a principle of maximizing the total gain of importance scores during a game can be used to incorporate ... changes, position change, and advanced plays. • Evaluation of team plays concern average forms, forms at a certain moment, players' location, indi- cation of the active or problematic...

Xem thêm