Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt

... FHV -1, those cats in a shelter or a breeding cattery had a low detection rate of C. felis. These results indicate that the Prevalence of FHV -1, FCV and C. felis in an animal shelter 209clinical ... C, Harbour DA, Graat EA. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis and Bordetella bron-chiseptica in cats: ... think that the results are due to that many shelter cats have been infected with FHV-1 and they remain subclinical carriers after recovery. At least 80% of infected cats remain latently infected...

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... acquisition, analysis of the data, statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, analysis of the data, and drafting of the manuscript. JD was responsible ... chronic health evaluation score at day 0. SOFA is the sepsis-related organ failure assessment score at screening day. Renal failure is creatinine clearance <50 ml/minute. LOS, length of stay at ... prescription and eliminating the use of pull down menus. For example, in the case of vancomycin prescriptions, physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose accord-ing...

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... years (p<0.0 01, OR=3.9). Interestingly, there was a statistically signif-icant association between OAB and hepatitis (p=0.03, OR=2.2). See Table 3. Table 2. Prevalence of OAB, LUTS and ... 2010.11.12 Abstract Purpose: We assess the prevalence of overactive bladder (OAB) a n d i t s r i s k f actors i n a m a l e urologic veterans population. Materials and Methods: Validated self-administered ... presented as odds ratio and 95% confidence interval (95% CI) 10. Statistical analyses were performed using Stata 8.2 (StataCorp, College Station, TX). RESULTS Among the male patients, 1086...

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... results indicatethat agmatine cannot fulfill the physiological roles of polyamines, and at the same time strongly suggest thatT. cruzi does not contain agmatinase activity thatwould convert agmatine ... forward and reverse primers pNeo 1 (5¢-CCGGAATTCTGAATGAACTGCAGGACGAGGCAG-3¢) and pNeo 2 (5¢-CCGGAATTCCGGCCATTTTCCACCATGATATTC-3¢), respectively. The labelled probe specificfor rRNA 24Sa was ... latter DNA was obtained by PCRamplification using a recombinant plasmid containing thecruzipain gene as template and primers A (5¢-ATGTCTGGCTGGGCGCG-3¢; forward) and B (5¢-GAGGCGACGATGACGGC-3¢;...

Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

... Manb1fi2Mana1fi2Mana1fi2Mana1fi2Man and Manb1fi2Manb1fi2Mana1fi2Mana1fi2Mana1fi2Man were obtained from the man-nan of C. albicans J-1012 (serotype A) [16].Preparation of mannanYeast cells were grown at ... Shibata, N., Onozawa, M., Tadano, N., Hinosawa, Y., Suzuki, A. ,Ikuta, K., Kobayashi, H., Suzuki, S. & Okawa, Y. (1996) Struc-ture and antigenicity of the mannans of Candida famata and Candida ... Okawa, Y., Goto, K., Nemoto, S., Akashi, M., Sugawara, C.,Hanzawa, M., Kawamata, M., Takahata, T., Shibata, N.,Kobayashi, H. & Suzuki, S. (1996) Antigenicity of cell wallmannans of Candida...

Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt

... TCAAAGAAGTCCTGAAGAGCGGGln11 (At5 g37600) F: CCTCTCAGACTCCACTGACAAAR: TTCACTGTCTTCACCAGGAGCGln12 (At1 g66200) F: TCTCAGACAACAGTGAAAAGATCAR: TGTCTTGACCAGGAGCTTGACGln13 (At3 g17820) F: GCCACCGGGAAAATCATCR: ... AATCGAAAACCCTTTCTTAAGLT (At5 g53460) F: TTGGACCTGAGCCAACACTTGR: CATCATCCGTTTTGGTGAGGAcarA (At3 g27740) F: TGGTCAGGTGGAGATCAGTGCR: GAGGCTTCAGGGTGGTACTGGcarB (At1 g29900) F: AGGAAGACCACATGCTGCTGAR: TCAAAGAAGTCCTGAAGAGCGGGln11 ... 5¢-GAGCATCTTTGACAACTCCATGTG-3¢;GLU2 forward, 5¢-TCGTGGTGGTTGATTCATTTT-3¢; GLU2reverse, 5¢-TGTGTTCCATACAACCAAGTGC-3¢; carAforward, 5¢-CACACCAATCTTTACGAGT-3¢; carA reverse,5¢-CGACAGAAACCCTAAATCCACCGC-3¢;...

Báo cáo khoa học: "Detection of Bartonella species from ticks, mites and small mammals in Korea" pps

... ...

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... expression of variousalternative reading frame proteins (ARFPs), alsonamed Core+1 proteins, resulting from mechanismssuch as ribosomal frame shifting and internal initiation at alternative AUG or ... Natick, MA, USA) at a ﬂow rate of 5 lLÆmin)1. Calibration was achieved in the positive ionmode, using denaturated horse heart myoglobin (Sigma).Human sera and ELISAMicroplate wells were coated ... water bath and calibrated with ammoniumd-10-camphorsulfonate. Spectra were acquired at 20 °C,with a constant bandwidth of 2 nm and a 3–5 s integra-tion time. Spectra were recorded using a...

Báo cáo khoa học: " Prevalence of porcine reproductive and respiratory syndrome virus, porcine circovirus type 2 and porcine parvovirus from aborted fetuses and pigs with respiratory problems in Korea" pot

... ...

Báo cáo khoa học: " Prevalence of Porcine Proliferative Enteropathy Its Control with Tylosin in Korea" ppsx

... ...

Xem thêm