Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf
Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the specificity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf
... Factors affecting the specificity of Fpg and OGG1FEBS Journal 275 (2008) 3747–3760 ª 2008 The Authors Journal compilation ª 2008 FEBS 3755 Ionic strength and magnesium affect the specificity of Escherichia ... independently evaluate the effects of ionic strength and Mg2+on the activity and specificity of OGG1, we measured the apparent values of k2 and k3under conditions of low salt (KPionly) and no Mg2+,low ... compo-sition, ionic strength, Mg2+concentration and severalother factors.ResultsEffects of ionic strength and divalent cations on the activity and specificity of Fpg and OGG1 The conditions inside...
- 14
- 567
- 0
Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx
... QDs can induce signaling implicated in the response to hypoxia and can reduce the rate of fat oxidation in PC12 cellsWe hypothesized that QDs and CoCl2 induce the accu-mulation of lipids in ... Nanoparticle-induced metabolic changes FEBS Journal 276 (2009) 6204–6217 ª 2009 The Authors Journal compilation ª 2009 FEBS 6209 Nanoparticles can induce changes in the intracellular metabolism of lipids ... NPs can affect the intracellular metabolism of lipids and induce HIF-1a-mediated signaling. The results suggest that QDs, together with trophic factors,promote the accumulation of lipids in cytoplasmicLDs,...
- 14
- 540
- 0
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
... SREfos5Â-d(GGATGTCCATATTAGGACAT)-3Â reproduces the sequence of the SRF recog-nition element of the c- fos enhancer [2,27]. The mut-ants SREGfos5Â-d(GGATGTgCATATTAGGACAT)-3Â andSREGGfos5Â-d(GGATGTggATATTAGGACAT)-3Â ... ê 2007 The Authors Journal compilation ê 2007 FEBS 2339 C fi G base mutations in the CArG box of c- fos serum response element alter its bending flexibility Consequences for core-SRF recognition Josef ... various interac-tions connecting the bases of the CArG box play the key role in the physiological activity of DNA.Experimental proceduresOligonucleotides The oligonucleotide SREfos5Â-d(GGATGTCCATATTAGGACAT)-3Â...
- 16
- 538
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5Â-GAAGTTAAAGATACAATGATTCAGCTC 5Â-GAGCTGAATCATTGTAACTTTAACTTC-3Â 48N302D 5Â-CATTGTTGAAGACATCAATGTTG-3Â 5Â-CAACATTGATGTCTTCAACAATG-3Â 43N302F 5Â-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3Â 5Â-GCTGCAACATTGATGAATTCAACAATGTAAAG-3Â ... 5Â-CAACATTCCTTGTCATCGAACCAAACTC-3Â 58R103M 5Â-GTTCGAGAACAATGAATGTTGTGTTC-3Â 5Â-GAACACAACATTCATTGTTCTCGAAC-3Â 55R103E 5Â-GAACACAACATTCTCTGTTCTCGAACC-3Â 5Â-GGTTCGAGAACAGAGAATGTTGTGTTC-3Â 55DKR 5Â-GAAGTTAAAGATACAATGATTCAGCTC ... 5Â-TCCGTATGGCGGCTCCGCTTCTAGTC-3Â 5Â-GACTAGAAGCGGAGCCGCCATACGGA-3Â 58I371K 5Â-TCCGTATGGCGAAACCGCTTCTAGTC-3Â 5Â-GACTAGAAGCGGTTTCGCCATACGGA-3Â 58K484M 5Â-GATACCGATGAGATGGGTGGGCAGTTTAG-3Â 5Â-CTAAACTGCCCACCCATCTCATCGGTATC-3Â...
- 12
- 380
- 0
Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx
... ê 2008 The Authors Journal compilation ê 2008 FEBS A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona Tetsuro Samata, Daisuke Ikeda, Aya Kajikawa, Hideyoshi ... Murayama E, Inoue H, Ozaki N, Tohse H,Kogure T & Nagasawa H (2004) Characterization of Prismalin-14, a novel matrix protein from the prismaticlayer of the Japanese pearl oyster (Pinctada fucata).Biochem ... Hideyoshi Sato, Chihiro Nogawa, Daishi Yamada,Ryo Yamazaki and Takahiro AkiyamaLaboratory of Cell Biology, Faculty of Environmental Health, Azabu University, Sagamihara, JapanSubsequent to the pioneering...
- 13
- 425
- 0
Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf
... involvement of caveolin-1 in an irradiation injured spinal cord was exam-ined by analyzing the phosphorylation of caveolin-1 in the spinal cord of rats after irradiation with a single dose of 15 ... expression, and ex-amine the changes in the phosphorylation of caveolin-1 (p -caveolin-1) in the spinal cord of rats after irradiation. p -caveolin-1 in the spinal cord of irradiated rats 327and prognostic ... activation in the micro-glia are associated with the phosphorylation of caveolin-1 in the spinal cord of irradiated rats, leading to the activation of microglia. Furthermore, gamma irradiation induces...
- 5
- 205
- 0
Báo cáo khoa học: " Radiation-induced skin injury in the animal model of scleroderma: implications for post-radiotherapy fibrosis" ppt
... point for skin injury represents the median value for the group. The error bars represent minimum and maximum value of the range. Each point for leg extension data represents mean value for the ... skin of C57BL/6 mice com-pared to TSK mice (p < 0.05). The TGF-β1 values corre-lated with the degree of skin injury and fibrosis seen at the end the study. The quantity of TGF-β1 in the skin ... 0.05).Consistent with the expected association of transforming growth factor beta-1 (TGF-β1) with latetissue injury, levels of the cytokine were significantly higher in the skin of the C57BL/6 mousecompared...
- 7
- 327
- 0
Báo cáo khoa học: " Intensity Modulated Radiotherapy (IMRT) in the postoperative treatment of an adenocarcinoma of the endometrium complicated by a pelvic kidney" pot
... vasculature, and the urinary tract. In one case an ade-nocarcinoma of the uterine cervix in a transplantedpatient was treated initially with Intracavitary BT (lowdose rate) followed by a modified ... a kidney graft in a patient with advanced carcinoma of the cervix by reimplantation of the graft from the pelvisto the upper abdomen in preparation for radiation therapy.Transplantation 1994, ... adenocarcinoma of the endometrium complicated by a pelvic kidneyMarcus S Castilho*, Alexandre A Jacinto, Gustavo A Viani, Andre Campana, Juliana Carvalho, Robson Ferrigno, Paulo ERS Novaes, Ricardo...
- 5
- 413
- 0
báo cáo khoa học: "Evolutionary relationships based on in the Sativa group of Oryza isozyme data" docx
... form of O. rufipogon on the one hand but the lack of differentiation of the American form of O. rufipogon on the other hand.IV. DiscussionA high degree of isozyme ... ge-nerally only once.It appeared that the interrelationships among strains at the isozyme level did notalways reflect their classification on the basis of conventional taxonomy, ... differentiation has arisen.A. The pattern of interrelationships among the Sativa group The Sativu group was defined on the basis of meiotic chromosome pairing (Mo-RINAGA, 1964) as...
- 26
- 325
- 0
báo cáo khoa học: " Placenta increta causing hemoperitoneum in the 26th week of pregnancy: a case report" ppt
... describe a case leading to uterinerupture associated with massive intra-abdominal hemorrhage. Case presentation: A 34-year-old Caucasian Albanian woman, gravida 2, para 1, was admitted to the emergencydepartment ... emergencydepartment of our hospital for acute abdominal pain associated with profound secondary anemia. Ananatomopathological diagnosis of placenta increta destruens was made. An urgent hysterectomy was ... such as hemor-rhage, uterine rupture and inversion, and invasion of the urinary bladder, are all related to the site of placentalimpl antation, the depth of myometrial invasion, and the width of...
- 3
- 302
- 0
Báo cáo khoa hoc:" Despite WT1 binding sites in the promoter region of human and mouse nucleoporin glycoprotein 210, WT1 does not influence expression of GP210" pptx
... 1 of 11(page number not for citation purposes)Journal of Negative Results in BioMedicineOpen AccessResearch Despite WT1 binding sites in the promoter region of human and mouse nucleoporin ... identified in the promoter region of the human GP210 gene, experimental modulation of WT1 expression did not influence expression of GP210. Therefore, WT1 is probably not regulating GP210 expression. Instead, ... targetgenes for WT1. This could include the gene for GP210, butpresumably not other nucleoporins. In the only previ-ously reported nucleoporin promoter region, of mouse nup358, several binding sites...
- 11
- 274
- 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt
... 1):1432-1441.doi:10.1186/1465-9921-12-52Cite this article as: Seeley et al.: Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury. Respiratory ... 0.05.Table 3 Multivariate adjusted odds ratio of death for selected variables on day 1, day 6 and the change in eachvariable between day 1 and day 6 Day 1 Day 6 Δ Day 1 ➔ Day 6Variable OR* ... mortality.Conclusions: A low respiratory system compliance on day 6 or a decrease in the respiratory system compliance between the 1stand 6th day of mechanical ventilation were associated with increased...
- 8
- 351
- 0
Báo cáo khoa học: "Diet-induced bacterial immunogens in the gastrointestinal tract of dairy cows: Impacts on immunity and metabolism" ppsx
... intake with increasing the amount of grain in the diet may be due to enhancedrelease of endot oxin and other bacterial immunogens in the digestive tract and their translocation into blood.Increased ... barley grain was included into the diet of dairy cows. In contrast, in the study of Khafipouret al. [4], replacing 21% of the DM of the control diet (F:C = 50:50) with pellets containing 50% ... concentrations were not affected by the amount of barley g rain in the diet. Their study reve ale dthat the increase in rumen endotoxin in response to highgrain diet, and the resulting increases in...
- 7
- 283
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ