Báo cáo khoa học: "Effects of DDA, CpG-ODN, and plasmid-encoded chicken IFN-γ on protective immunity by a DNA vaccine against IBDV in chickens" pps
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... /angles at position 157 are in a region of the Rama-chandran plot that is allowed only for glycine. Substi-tuting any amino acid at this position would result in a change in the conformation ... conformation of this loop. Changes in the conformation of the backbone at this point and changes in the orientation of other side chains, as a result of the introduction of the large charged aspar-tate ... ultracentrifugation samples, A. Padovanifor making the W56F variant and J. A. Kornblatt forencouragement and advice. Financial support wasprovided by the Natural Sciences and EngineeringResearch Council...
- 10
- 520
- 0
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt
... h), indicating that no peptide aggregationoccurred during this interval.The addition of Ab to a lipid bilayer containing onlySM again resulted in increasing spectral shifts to higherincident ... binding of the peptideto the bilayer as a function of added Ab con-centration. The binding constant wasobtained by a hyperbolic fit to the data (solidline) with a KDvalue and total spectral ... molecular interactions at surfaces and interfaces. Spectroscopy 15, 161–175.35 Salamon Z, Devanathan S, Alves I & Tollin G (2005)Plasmon-waveguide resonance studies of lateral segrega-tion of...
- 14
- 532
- 0
Báo cáo khóa học: Effects of Escherichia coli ribosomal protein S12 mutations on cell-free protein synthesis doc
... reading frame.Amino acid numbering starts from the N-terminal amino acid.Resistance level determined after a 24 h incubation on LB agar.StrainPosition of mutation in rpsLAmino acidreplacementResistance ... decrease in the translational accuracy [7,8]. In the 1980s, mutations conferring streptomycin resistancewere found in the 16S rRNA of bacteria and chloroplasts(rRNA Mutation Database, located at ... 90–99.31. Inaoka, T., Kasai, K. & Ochi, K. (2001) Construction of an in vivononsense readthrough assay system and functional analysis of ribosomal proteins S12, S4, and S5 in Bacillus subtilis....
- 8
- 392
- 0
Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx
... 30].Serum and BSA are the most common components of media for mammalian embryo culture. Serum, which con-tains hormones, growth factors, vitamins, peptides, and anarray of defined and non-defined ... 1320-1325.12.Lee, E. S. and Fukui Y.Synergistic effect of alanine and glycine on bovine embryos cultured in a chemicallydefined medium and amino acid uptake by in vitroproduced bovine morulae and blastocysts. ... without amino acids had no effect on in vitro culture,but with non-essential amino acids stimulated blastocystformation. According to Liu and Foote [14] nonessentialamino acids (NEAA) have a stimulatory...
- 6
- 514
- 0
Báo cáo khoa học: " Effects of endomycorrhizal development and light regimes on the growth of Dicorynia guianensis Amshoff seedlings" pptx
... endomycorrhizal infection.2.6. Data analysisUsing Statview 4.5 from Abacus Concepts Inc., a fully factorial ANOVA analysis of the data at harvestwas performed in order to detect any interactionsbetween ... F .A. , Walker N .A. , Effect of photon irradiance on the growth of shoots and roots, on therate of initiation of mycorrhizal infection and on the growth of infection units in Trifolium subterraneum ... is part of a cooperative programme on the determinism of the natur-al regeneration of the tropical rainforest.2. MATERIALS AND METHODS2.1. Site location, seed harvesting and plant materialThis...
- 9
- 342
- 0
Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc
... arrowindicates the DNA fragment that containsthe original MsH43 sequence, and asterisksmark the DNA fragment containing altera-tions in the size of MsH43 (unequal recomb-inants). (B) Analysis ... understandard conditions [8]. After incubation, DNA wasextracted and used to transform bacteria. The recombi-Effect of cations and G-quartets on recombination P. Barros et al.2984 FEBS Journal ... theexperiments containing KCl, NaCl, or NH4Cl, the saltswere added to a final concentration of 20 mm. Severalconcentrations of salts were assayed (5, 10, 15, 20, and 25 mm), and a concentration of 20...
- 11
- 472
- 0
Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx
... reverseCTCGCGGGCTCGGCAGTGGGAGPprom+1AGTCTATTCTCGAGCACCTGGGACTACAGGPprom+2AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAGPprom+3AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCAPprom+4AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGACPprom+5AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTCPprom+6AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTGPprom+7AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAGPpromreverseAGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAGPORE ... EMSA.Primer ID Sequence (5’- to 3’)P-1cowTCTTGCGGCTTGGAGAGAGCCAGP-2cowCCAGAACGCGACCCAGGTCP-3cowCAGGTCTGCAGAGCAAGCAACAGP-1ratTAGTTGCAAGCTGAAGACCGP-2ratGCTGAAGACCGCGGAGGTACP-3ratGAGGTACCCAGAACTGCCCTGP-1mouseGATAGTCAGTGGGGGAAACCTCAGP-2mouseCAGCAAAAGAGGGCTGTGTGGTGP-3mouseTGGCCGCCACGAACATCCCATCPpromoter ... supplemented with 10%fetal bovine serum and 1% penicillin–streptomycin.RNA isolation and quantitative PCRLung, heart, small intestine, aorta and trachea RNA isola-tions and quantitative PCR with specific...
- 12
- 333
- 0
Tài liệu Báo cáo khoa học: Effects of sequestration on signal transduction cascades docx
... potential for oscillations induced by negative feedback.AbbreviationsJAK, janus kinase; MAPK, mitogen-activated protein kinase; MAPKK, mitogen-activated protein kinase kinase; MCA, metabolic control ... phosphatase concentrations of MAPK- and MAPKK-phosphatase are lowered to onefifth of the kinase concentrations (while increasingtheir catalytic activity by factor five to keep the Vmaxvalue constant). ... dynamics of a cova-lent modification cycle and may account for signal termination and a sign-sensitive delay. Finally, we analyse the effect of sequestration on thedynamics of a complex signal...
- 12
- 510
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM