Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... revealed a
characteristic time-dependent increase of the mRNA abun-
dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and
P4ha2, starting around 4 h of hypoxia, the induction of
P4ha2 mRNA being ... as the relative mRNA/b-actin mRNA ratio. The
mRNA/b-actin mRNA ratio of the time standards (pools)
cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data
are therefore...
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... the putative
polyadenylation signal AATAAA, and also the sequences
upstream and downstream of the canonical polyadenylation
signal are important for protein binding to D-TERM DNA.
The binding specificity ... however,
yielded a major termination downstream of AAUAAA
signal at the end of CAA*, A being the terminal nucleotide
16 295 of the mouse mt genome (189 nt tra...
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/
TRAF1, respectively. Primers for amplifying the 4-1BB and
TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA
AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG
CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1
cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG
AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG
GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In
order to overexpress 4-1BB and TRAF1 in the HeLaTR...
Báo cáo khoa học: " Ipsilateral irradiation for well lateralized carcinomas of the oral cavity and oropharynx: results on tumor control and xerostomia" pot
... nutri-
tion and speech, and accelerating dental decay [1]. Xeros-
tomia is caused from bilateral irradiation of the major
serous-producing glands, mainly the parotids, and the
minor salivary glands ... This was likely related to the combined sparing of
the contralateral parotid and part of the contralateral sub-
mandibular gland. Certainly, the salivary function...
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... to
emphasize what Streat and coworkers [15] termed, the large
risk of unacceptable badness’, rather than a vanishingly small
potential for benefit.
There are far worse things than death, and many of ... unsuccessful in achieving a
stated goal. Therefore, if a patient in a progressive,
inevitable death spiral is placed on mechanical ventilation,
it is not technically futil...
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... Y, Sakai F & Nagahama Y (2010) Doublesex-
and Mab-3-related transcription factor-1 repression of
aromatase transcription, a possible mechanism favoring
the male pathway in tilapia. Endocrinology ... males, abundant dmrt1 expression during
preparatory and prespawning and spermatogenesis
periods was seen, in contrast to a gradual decrease
thereafter during spawning ⁄ spe...
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx
... Institutional
Animal Care and Use Committee of the Center South Uni-
versity, and were carried out in accordance with the
National Institutes of Health Guide for the Care and Use
of Laboratory Animals. All ... min. After centrifugation
(10 000 g, 1 min, 4 °C), the protein concentration in the
supernatant was determined using the BioRad protein
assay. Supernatants c...
Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx
... thdc nay la phdng vien,
bien tap vien ed uy tin, cd kinh
nghiem eua Dai. Mdt
.sd
nha
bao trong Diin din Kinh te,
Diin din Khoa hpc va Cdng
nghi.
Bin trdn im nhac, Diin
dan Giio
due
da ... trade ma phai bat
ra tu hien thyc sinh ddng, Ngudi
ndi phai xu ly cung mdt
ldc
rat
nhidu cdng viee: vua quan sat
hinh anh thu dugc td camera,
quan sat mdn hinh bien tap, ket
ndi dien t...
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
ACAAUGUGAAA
GCAAUGUGAUA
5′
3′
UAAAUGUGAAU
ACUAAGAGUAA
GCAAUGUGAUA
IL6R mRNA mut 1
5′
3′
UAAAUGUGAAU
ACAAUGUGAAA GCUAAGAGUUA
IL6R ... 5′3′
3′
UAUAAGAGUAU
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
3′ 5′ 3′ 5′ 5′3′
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
3′ 5′ 3′...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật