Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf

Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf

Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf

... number of activities together, but mainly based on farming and craft making. However, agricultural 50 Changing of Women’s Roles in Agricultural and Handicraft Production: The traditional ... 1. Craft making only (loaned farmland to other villagers) 30 2. Craft making and rice cultivation in allocated land only 40 3. Craft making and rice cultivation...
Ngày tải lên : 06/08/2014, 19:20
  • 11
  • 425
  • 0
Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc

Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc

... the same areas. Although our data did not elucidate the physiological role and action mechanism of PACAP in human placenta, the localization of PACAP and its PAC 1 receptor in the same areas strongly ... suggest that PACAP may act as an autoregulator or pararegulator via its PAC 1 receptor in stem villi and terminal villi during pregnancy. In conclusion, our findings sugges...
Ngày tải lên : 07/08/2014, 18:21
  • 5
  • 349
  • 0
 Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

... the same number of interns, in the traditional arm would have meant that each intern admitted and cared for more patients. In other words, each intern would have had a heavier workload and, therefore, ... performance of upper-level residents and other medical staff across a variety of disciplines. We likewise agree that optimizing patient hand- offs, medical education, and...
Ngày tải lên : 25/10/2012, 10:45
  • 3
  • 514
  • 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

... transferred to a new Petri dish and incu- bated overnight with medium containing gentamicin. Bacterial growth of each strain was assessed by viable counts, both during initial infection and also ... GST-ExoS(DALDL424–428AAAAA) S 419 QGLLAAAAA 428 This study 7. GST-ExoS(D42 4A; D42 7A) S 419 QGLLAALAL 428 This study 8. GST-ExoS(S419I) I 419 QGLLDALDL 428 This study 9. GST-ExoS(Q4...
Ngày tải lên : 19/02/2014, 08:20
  • 9
  • 525
  • 0
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... only minor confor- mational changes upon binding the twin-arginine signal peptide of NapA [18]. In this case, biogenesis of the NapA protein is assisted by NapF in charge of cofactor loading [19,20]. ... considerable research into chaperone function, only partial structural information has been gained on the nature and site of peptide interaction [9–12]. Biophysical studies hav...
Ngày tải lên : 16/02/2014, 14:20
  • 10
  • 685
  • 0
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf

... their binding to the RNA-induced silencing complex loading complex proteins HIV transactivating response RNA-binding protein and Dicer in H1299 cytoplasmic extracts. Binding of siRNA and the transactivating ... Dicer and Ago2 alone are capable of forming an active mini- mal RLC [13]. Being double-stranded, either strand of the siRNA can be used as the guide strand of an active...
Ngày tải lên : 18/02/2014, 06:20
  • 10
  • 700
  • 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-CTTCCTCCGCTTCCATGA-3¢) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ and ‘Qa’ refer, respectively, ... generated by 5¢- and 3¢-RACE using the Marathon cDNA amplification kit (Clontech, Takara, Mountain View, CA, USA). Double- stranded cDNA from oyster mantle edges was ligated to ada...
Ngày tải lên : 19/02/2014, 00:20
  • 9
  • 584
  • 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

... B2-linker-ATTGTAACGGCTATATCTACTGG ALR-c36SU3¢ B2-linker-GGCAAGAAGCTCGAAATAACC ALR-c63SU3¢ B2-linker-CCAATAGCTGGCCAAGAACC ALR-c96SU3¢ B2-linker-ATTCATACCGAAAAGACC C ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC ALR2-HIS-r ... ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC ALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTC ATGTTAATTGTAACGGCATCGATGAATT CGAG...
Ngày tải lên : 19/02/2014, 06:20
  • 14
  • 607
  • 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

... (Genesearch, Arundel, QLD, Australia). Plasmids and cDNAs The mammalian expression plasmid, pcDNA3 (Invitrogen, Melbourne, VIC, Australia), containing N-terminally flag- tagged human Salvador (hSav) cDNA ... A. Callus 1, *, Anne M. Verhagen 1 and David L. Vaux 1, * 1 The Walter and Eliza Hall Institute, Parkville, VC, Australia The mammalian serine ⁄ threonine kinases, Mst1 and Mst2,...
Ngày tải lên : 19/02/2014, 06:20
  • 13
  • 321
  • 0
Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... results indicate that agmatine cannot fulfill the physiological roles of polyamines, and at the same time strongly suggest that T. cruzi does not contain agmatinase activity that would convert agmatine ... 633 Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes Marı ´ a P. Serra, Carolina Carrillo, Ne ´ li...
Ngày tải lên : 19/02/2014, 07:20
  • 10
  • 570
  • 0

Xem thêm

Từ khóa: