Soil microbial indices as bioindicators of environmental changes in a poplar plantation pot
Soil microbial indices as bioindicators of environmental changes in a poplar plantation pot
... Ecological Indicators 5 (2005) 171–179This article is also available online at:ww w .els e vie r .com/loca t e/ecolind Soil microbial indices as bioindicators of environmental changes in a poplar ... during the last 2 years. Aim of this paper was to assess the validity of the microbial indices as bioindicators of microbial processes induced by the two treatments: FACE and N fertilization.2. ... due to an increase of microbial activity resulting in an acceleration of soil organic matter mineralization as substrate and energy source (Kuzyakov et al., 2000). The addition of inorganic...
- 9
- 265
- 0
Benthic algae as bioindicators of agricultural pollution in the streams and rivers of southern Que´bec docx
... sites and the rest of the agriculturally impacted sites.Another CCA analysis was performed to include all water quality variables as well as land use data for eachsampling site. Adding land ... that each explained significant directions of variance in the distribution of the taxa. The statistical significance of the relationship between algal taxa and environmental variables was ... importance of local farming practices. The use of periphyton as a bioindicator provides an integrated measurement of water quality as experienced by the aquatic biota, and therefore offers a useful...
- 25
- 354
- 0
Working PaPer SerieS no 1273 / DeCeMBer 2010: intereSt rate effeCtS of DeMograPhiC ChangeS in a neW-keyneSian life-CyCle fraMeWork pptx
... adjustments.4 As already stressed, our framework can be used to address a variety of macroeconomicquestions. In this particular paper, because of its predominantly long-run focus, themonetary margin plays ... tractability $ and areassumed t o be independent of the age of agents, similar t o Blanchard (1985) and Weil(1989). However, we assume that the three demographic variables of interest, namely qzw>$w> ... cut-o feature of the empirical data set, namelyto assume that all persons at age 65 or above are assumed to have retired. Third, in calibration exercises of this type there is some leeway to x...
- 49
- 455
- 0
Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps
... the in- creased supply of available carbon, and the higher tem-perature and moisture content, factors that favour a rapidincrease in the microbial population. Increased microbial biomass may also ... byhigh rates of root respiration due to the fast growth of grass in these plots and by the higher microbial activity, as shown by the increases in microbial biomass.The increased microbial biomass ... objective of thisresearch was to examine the effect of harvesting andslash management on mineralization of soil organic mat-ter in a forest soil intensively managed. In a previous pa-per [28],...
- 12
- 312
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... weaker due to the fact that two non-canonical G:Ubase pairs presented in the plus-sense RNA occur as non-pairing C /A bases in the minus-sense RNA. Interestingly, in Puumala hantavirus, a hairpin-like ... S RNA of TULV.GGAAAUG GCCAAGUG-C A- UG-C A- UU -A G GU -A G:UC A- UU -A 337 381(+) senseU:GU -A C UC-GU -A C-GU -A C-GU -A A-UC C A- UC A GU -A A-U(-) sense A C A- UG A G-C A- UCCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt831–855). To monitor the presence of recTULV S RNA,RT-PCR was performed with primers RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) andHairpin-like...
- 5
- 483
- 0
báo cáo hóa học: " The Second Young Environmental Scientist (YES) meeting 2011 at RWTH Aachen University environmental challenges in a changing world" potx
... 30 years of habitat managementSizmur et al., University of Reading, UK Innoculation of earthworms during contaminated land relamation and restoration:impacts on metal mobility and availabilityThüns ... MatthiasLeonhard Berens. The video (Link),aswellasabstracts of poster and platform presentations (Link) are freelyaccessible as supplemental material (see additional files1 and 2) of this article. ... to get in contact with potential future employers . The parti cipat-ing companies attracted a lot of students asking for jobs as well as internships Environmental challenges in a changing world”...
- 4
- 319
- 0
Tài liệu Animals As Sentinels Of Environmental Health Hazards docx
... more available at http://www.nap.eduAnimals as Sentinels of Environmental Health Hazards http://books.nap.edu/catalog/1351.htmlAnimals as Sentinels of Environmental Health Hazards 17About ... http://books.nap.edu/catalog/1351.htmlanimal testing data usually are a principal component of the basis for riskassessments.Animals outside the laboratory can yield information at each step in riskassessment—risk ... contamination of the animal's environment, of other animals andhumans that share the animal's environment, and of humans that ingest theanimals and animal products. Although food animals...
- 20
- 328
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... vitamins. The next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving. Another excerpt notes that a particular ... in its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark. The Examining Attorney was not persuaded by applicant’s ... cologne and skin cream contain vitamins. The second article contains recipes for skin care products based on fruits and vegetables. A third article discusses exfoliating skin creams which contain...
- 8
- 416
- 0
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc
... cannot generally be compared because KDismeasured in solution whereas KD¢ is measured at theinterface between a solid and a liquid phase, and cal-culated as the ratio of two rate constants. ... which MalE-E3-H6 wasimmobilized in the wells of a microtiter plate and the boundFab4E11-H6 was revealed with a goat antibody, directed againstmouse Fab and conjugated with alkaline phosphatase. ... type or Ala as in the L-R9 0A mutant. It wasidentical to 1 ⁄ 9A when residue L-90 was Gln as in thegermline antibody (Table 4). The canonical structure1 ⁄ 9A of L-CDR3 is a b-hairpin, distorted...
- 13
- 658
- 0
International Accounting Standard 21 The Effects of Changes in Foreign Exchange Rates potx
... preparing financial statements or an entity preparing separate financial statements in accordance with IAS 27 Consolidated and Separate Financial Statements to present its financial statements in any ... normal consolidation procedures, such as the elimination of intragroup balances and intragroup transactions of a subsidiary (see IAS 27 and IAS 31 Interests in Joint Ventures). However, an intragroup ... determined by comparing: (a) the cost or carrying amount, as appropriate, translated at the exchange rate at the date when that amount was determined (ie the rate at the date of the transaction...
- 10
- 523
- 1
Từ khóa: effects of environmental pollution in usaeffects of environmental pollution in indiacauses and effect of environmental pollution in nigeriaspeed of light of different colors in a vacuumwhat is the role of individual initiative in a capitalist economythe role of activation energy in a chemical reactionBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ