0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Toán học >

A characterization of pick bodies

A characterization of pick bodies

A characterization of pick bodies

... thatevery Q-algebra is in fact an operator algebra, results about operator algebrasautomatically apply to Q-algebras. And consequently, general results about the unitball of an operator algebra ... unit ball of a finite dimensional semisimple Q-algebra.We now turn our attention to a broader class of Banach algebras: finitedimensional commutative algebras of operators on Hilbert space. ... slight modification of a theorem due to D. Sarason which gives a representation of Pick algebras as singly generated algebras of operators on a Hilbert space. Sarason's theorem...
  • 13
  • 151
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Implementing a Characterization of Genre for Automatic Genre Identification of Web Pages" pot

... more dynamic view of a genre classification system. Automatic identification of text types and genres represents a great advantage in many fields because manual annotation is expensive and time-consuming. ... research the assessment of the model as a whole. In this paper, we report a partial evaluation based on single-label classification accuracy and predictions. From a theoretical point of view, ... blog_augustine_0000024 704 of being argumentative_persuasive shows a high gradation of argumentation. Gradations/ probabilities are ranked for each web page. The computation of text types as...
  • 8
  • 318
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "A CHARACTERIZATION OF CHAOTIC ORDER" pdf

... Yamazaki, Characterizations of logA≥ logB and normaloid operators via Heinz inequality,In-tegral Equations and Operator Theory 43 (2002), no. 2, 237–247.Changsen Yang: Department of Mathematics, ... Henan Normal University, Xinxiang,Henan 453007, ChinaE-mail address: yangchangsen0991@sina.comFugen Gao: Department of Mathematics, Henan Normal University, Xinxiang, Henan 453007, ChinaE-mail ... Uchiyama’smethod—associated with Furuta and Kantorovich type operator inequalities, Mathematical In-equalities & Applications 3 (2000), no. 3, 423–436.[4] K. Tanahashi, Best possibility of...
  • 6
  • 197
  • 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

... and analysis of Langmuir probe characterization for ECR plasma. Indian J. Phys. 80: 1011–1015Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beamresults, ... mirror, and flat magnetic field configurations. A mirrorratio of 1·1 and a maximum flat field of 1400 G has been obtained. The measured values andthe design values are found to have a good agreement ... Imperfections inS¯adhan¯ a Vol. 35, Part 4, August 2010, pp. 461–468. © Indian Academy of SciencesDesign, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton...
  • 8
  • 650
  • 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

... was maintained byusing beryllium metal foil to seal the X-ray optical path.Table 2. Summary of DSC data, suggested results, and additional characterizationssample no. peak onsets (°C) peak ... nitrogenpurge.Evolved Gas Analysis. Simultaneous TG/MS and TG/gaschromatography (GC)/MS analysis were performed on severalsamples. A split was used to send a fraction of the evolvedgases to a quadruple mass ... TGA analysis was performed on severalsamples using a TA 2950 TGA with a platinum pan. A nitrogenatmosphere was used for each trial. Some analyses wereperformed on a Perkin Elmer-7 TGA with an...
  • 16
  • 549
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. Theprimers ... depletion of a molar equivalent of dissolved O2. HPLC analysis of the products of the enzymatic transformationrevealed that Bxe _A2 876 catalyzed breakdown of theb-diketone substrate via oxidative carbon–carbon...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. ... molecular masswas also estimated by SDS–PAGE. Characterization and comparative analyses of HYDJsand HYDBpThe optimal temperature for activity of HYDJswith d-p-HPH as substrate was determined ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-ysis to amino acid-based chiral pharmaceuticals - exam-ples and perspectives. J Mol Catal B-Enzym 5, 1–11.14 Liljeblad A & Kanerva LT...
  • 14
  • 621
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 2008)doi:10.1111/j.1742-4658.2008.06352.xCone snails, a group of gastropod animals that inhabit tropical seas, arecapable of producing a mixture of peptide neurotoxins, namely conotoxins,for defense and predation. Conotoxins are mainly ... andsequence of dermorphin, a novel opiate-like peptidefrom the skin of Phyllomedusa sauvagei. Int J PeptProtein Res 17, 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, ... Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic omega-[L-Ser46]agatoxin-TK, exerts blockade of P-type calcium...
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ... Ala wascarried out using the QuickChange kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ andits complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢...
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu Ofrom Corynebacterium ... vanishedafter 30 min, and instead, an absorption peakappeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu-ally and was replaced by a new broad band...
  • 16
  • 617
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ