... DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 371 bp DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 292 bp DiagN1R GCATCAGGATAACAGGAGCA 794-775 ... Swayne DE and Halverson DA (2007), Diseases of Poultry: Influenza, 12th edn. Ames, IA: Blackwell Publishing Professional. 46. Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa ... of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker oAvian Diseases, 40:...