Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf
Báo cáo hóa học: " Research Article Hierarchical Spread Spectrum Fingerprinting Scheme Based on the CDMA Technique Minoru Kuribayashi (EURASIP Member)" docx
... is calculated using the variance of similarity measurements of all candidates. Because of the computational complexity in the calculation of similaritymeasurements, the number of candidates is ... reduces the computational costs by a factor of logscale. The idea is based on the observation that the userswho have similar background and region are more likelyto collude with each other. Their ... smallerthan that of the detection operation.For a comparison of the computational complexities, the time consumption is evaluated on a computer having anIntel Core2Duo E6700 CPU and 8-GB RAM....
- 16
- 311
- 0
Báo cáo hóa học: " Research Article QoS-Guaranteed Power Control Mechanism Based on the Frame Utilization for Femtocells Pavel Mach and Zdenek Becvar" pot
... consideration: adaptation interval Δt and poweradaptation step ΔP. As the length of the frame in LTE -A isset to 10 ms, it is convenient to set adaptation interval toconstantvalueof10msaswell(LTE-Aallowstoschedulereporting ... [14], the authors additionally contemplate anotherautoconfiguration scheme taking activity/inactivity of usersinto consideration. If no users of the FAPs are currentlyactive (no voice or data are ... adaptation intervalFM Fade margin to cope with fading effects3.4. Power Adaptation Algorithm. Table 2 summarizes a notation used in the description of the proposed algorithm. The dynamic adaptation...
- 16
- 400
- 0
Báo cáo hóa học: " Research Article Bleimann, Butzer, and Hahn Operators Based on the q-Integers" pdf
... Lipschitz-type maximal function and give a pointwise estimation. Then, a Stancu-type formula of the remainder of q-BBH is given. We will also give a generalization of these new oper-ators and study the approximation ... Department of Mathematics, Faculty of S ciences and Arts, Gazi University,Teknik Okullar, 06500 Ankara, TurkeyEmail address: ogun.dogru@gazi.edu.tr2 Journal of Inequalities and ApplicationsThere ... estimation in a general Lipschitz-type maximal function space. Finally, wede?fine a generalization of these new operators and study the uniform convergence of them.Copyright © 2007 A. Aral and...
- 12
- 383
- 0
Báo cáo hóa học: " Research Article High-Resolution Source Localization Algorithm Based on the Conjugate Gradient" pptx
... general a diagonal matrixwhen the sources are uncorrelated and is nondiagonal andpossibly singular for partially correlated sources. In practice, the data covariance matrix R is not available ... eigendecomposition of the observa-tion data covariance matrix. Instead, it uses a new basisfor the signal subspace based on the residual vectors of the CG algorithm. Numerical results indicate that the ... generate a signal subspace basiswhich is not based on the eigenvectors. This basis is rathergenerated using the residual vectors of the CG algorithm.Then, using the localization function and rank-collapse...
- 9
- 353
- 0
Báo cáo hóa học: "Research Article Towards a Performance Boundary in Calibrating Indoor Ray Tracing Models" pptx
... calibratedmodel outperforms the standard uncalibrated one with a mean error of 1.3 dB and a standard deviation of 4 dB.With an increasing size of the calibration set, the calibrationreaches a ... (used ascalibration data), (b) Tx1-Rx2 (not used as calibration data), and(c) Tx4-Rx1 (not used as calibration data).Table 3: Overall prediction error of the model before and aftercalibration.Parameter ... minimum and does not necessarilyprovide the optimal solution.As the relation between power taps and material param-eters is a nonlinear combinatorial relationship, the simulatedannealing approach...
- 8
- 306
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
... Gopal Ramakrishnan1, KB Ramachandran2,Guhan Jayaraman2and Subramanian Ramalingam1*AbstractIn this work, Lactobacillus reuteri has been metabolically engineered for improving 1, 3-propanediol ... sequence a yqhDF (Forward) 5’-CATG CCATGG ACAACAACTTTAATCTGCACACC-3’yqhDR (Reverse) 5’-CCGCTCGAG TTAGCGGGCGGCTTC-3’PorfXF (Forward)SppIP5’-TGAAAATTGATATTAGCG-3’MAGNSSNFIHKIKQIFTHR a The restriction ... native strain. Interestingly, the recombinant strain exhibited elevated rates of lactate and ethanol formation as well as reduced rate of acetate production, compared to the native strain. The preferential...
- 8
- 399
- 0
báo cáo hóa học: " Mild solutions for a problem involving fractional derivatives in the nonlinearity and in the non-local conditions" ppt
... El’sgol’tz LE: Qualitative Methods in Mathematical Analysis. Transaction on Mathematical Monographs, AmericanMathematical Society, Providence 1964, 12.14. Hughes DK: Variational and optimal control problems ... treat the fractional order case wheresome difficulties arise because of the non-local nature of the fractional derivatives. Inaddition to that, to the best of the author’s knowledge, fractional ... theory of cosine families.Fractional non-local conditions are the natural generalization of the intege r ordernon-local conditions as studied by Hernandez [5] and others. They include the discretecase...
- 12
- 384
- 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal of Neuroinflammation 2007, ... AY3572965'-GACCATCCAAGCAGACGTGGTA CCCACAGTCT TGCTTTAACG CTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3'MCP-5: GenBank Accessions # AC012294, NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal ... sequence was sequenced to confirm accuracy. A mutant sequence (5'-AAGCAGATTTGGTACCCT-TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGTGACTCAGAAA AGGACAAGGG GTGAGCCCAACCACAAGGCTGCT-3') was generated...
- 15
- 541
- 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx
... C, Barragan-Mejia G, Garrido-Garcia L, Cama-cho-Reyes L, Valencia-Salazar G, Paredes R, Romero L, Osnaya H, Vil-larreal-Calderon R, Torres-Jardon R, Hazucha MJ, Reed W: Elevatedplasma endothelin-1 ... city (Iztapal-apa), the organic fraction of fine particles (PM2.5) at the Centro Nacional de Investigación y Capacitación Ambien-tal (National Center for Environmental Research andTraining, ... includingviral infections and air pollutants may activate the pro-duction of ROS, thus resulting in inflammation in addi-tion to the asthmatic symptoms [26]. The maintenance of basal ROS generation...
- 11
- 511
- 0
Từ khóa: 2 applying a different stylesheet based on the time of dayvề khái niệm văn hoá trong các bài giảng bằng ngôn ngữ thứ hai on the notion of culture in l2 lectures tác giả j flowerdew và l miller tạp chí tesol quarterly vol 29 no 2 1995báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa họcbáo cáo y họcchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP