Báo cáo hóa học: " A Robust Color Object Analysis Approach to Efficient Image Retrieval" pdf
Báo cáo hóa học: "A Two-Step Hydrothermal Synthesis Approach to Monodispersed Colloidal Carbon Spheres" pdf
... potential applications, including high-density andhigh-strength carbon artifacts lithium storing materials[4–8], sacrificial template to fabricate hollow structures[9–16], catalyst support material ... the sealed autoclave washeated to 180 °C for 4 h along with constant stirring at*800 rpm, and then cooled to room temperature naturally.Finally, the suspension containing the as-prepared carboncolloids ... To prepare the SEM sample, a drop of thediluted suspension was placed on a glass slide and then itwas coated with gold prior to examination. The averageparticle size was estimated based on...
- 6
- 269
- 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... diagonal elements of Rη.Hence, the MAI covariance matrix Rηcan be approximatedas a block diagonal matrix and the block that appears in itsmain diagonal is given by (A. 4).Notethatsuchanapprox-imation ... MAI can be treated as a stochastic random pro-cess [16]. Specifically, MAI vector η can be modelled as a zeromean Gaussian vector with covariance matrix Rη= E[ηηH].Since the channel parameters ... increase. As a result, ma-trix [R(i,i)η]−1and accordingly matrix R−1ηtend to a diagonalmatrix with equal diagonal elements. In practice, matrix R−1ηpossesses a “heavy” main diagonal...
- 12
- 438
- 0
Báo cáo hóa học: " A Robust on-Demand Path-Key Establishment Framework via Random Key Predistribution for Wireless Sensor " doc
... Texas at Dallas. Her research in-terest is mainly in database systems, espe-cially in spatial database with applicationsin geographic information systems and bioinformatics, distributeddatabase ... Optimization and anEditor of the research monograph Clustering and Information Re-trieval. She is an Associate Editor of KAIS: An International Jour-nal on Knowledge and Information Systems and a ... a similar technique to discover shared keys. Although these new schemes save com-munication, they pose a security threat. After capturing a node, an attacker can gain additional advantage by...
- 10
- 247
- 0
Báo cáo hóa học: " A Robust Capon Beamformer against Uncertainty of Nominal Steering Vector" pdf
... shows that the proposed RCB canbe generalized as a diagonal loading approach. The diagonalloading factor is calculated from the constraint equation. Inthis paper, we derive the optimal output ... source on a far-field steering Applebaum array-two dimensional array case,” IEEE Transactions on Antennasand Propagation, vol. 36, no. 4, pp. 468–475, 1988.[6] S. A es and Y. Grenier, A signal subspace ... snapshots. It is well known that the co-variance matrix estimated using sample averaging methodasymptotically approaches the true one. In the case whereonly a small number of snapshots are available,...
- 8
- 221
- 0
Báo cáo hóa học: " A Robust Formant Extraction Algorithm Combining Spectral Peak Picking and Root Polishing" potx
... accuracy by adjusting the tolerance in (6). If the ap-plication requires more accuracy, then we need to adopt a smaller value for ε.Anε value of 10−4is generally suitable forreliably obtaining ... extractors based on rootssolving.This integration is performed in the vicinity of the peak.Let’s assume that the angle related to the spectral peakis φPEAK. The area that we want to examine ... formant extractors based on the root ex-traction algorithm have difficulty in selecting roots that aredirectly related to actual formants. However, in the case of theESPS formant extractor, a...
- 16
- 270
- 0
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot
... for each frame, withthe same band limitation and cepstral mean subtraction. Allmodels used 32 Gaussian mixtures with diagonal covariancematrices for each spe aker.6 EURASIP Journal on Applied ... (similar to cepstral mean removal) and with theaddition of the delta vector, was used in the experiments.Thus, there was a feature vector of twelve streams, six staticand six dynamic, for each ... may lead to a system that has potential to outperform the individual tech-niques in isolated operation. Examples of this research, fordealing with broadband noises such as in Aurora 2, can befound...
- 12
- 323
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttataSElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaaSElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaacSeo ... (’ 5to3 ’)SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaataSED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaataSEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaataSEG ... gcgcggatcctcaagttgtgtataaataSEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaagaSEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacataSElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx
... data collection, data analysis, data interpretation, manuscriptwriting, and final approval of manuscript. CN was involved in theconception and design of the study and data interpretation. AL ... Environ Health 1996, 68:88-93.26. Baldasseroni A, Bavazzano P, Buiatti E, Lanciotti E, Lorini C, Biggeri A: Occupational exposure to n-hexane in Italy, analysis of a registry ofbiological monitoring. ... Health1993, 65:71-74.25. Cardona A, Marhuenda D, Prieto MJ, Marti J, Periago J-F, Sanchez J-M:Behaviour of urinary 2,5-hexanedione in occupational co-exposure to n-hexane and acetone.Int Arch...
- 8
- 641
- 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx
... theyare cheap in general, commercially available, air stable crystalline solids, safe, and non-toxic, hence easy to handle.Results: Carbonyl compounds (aliphatic, heterocyclic, and aromatic) ... Surface area of thecatalyst before and after use in the reaction was mea-sured using surface area & pore size analyzer (NOVA1000e, Quanta chrome Instruments). All the chemicalswere used as-received.5. ... lactams in acetonitrile. J Org Chem72:4536–4538. doi:10.1021/jo070297k.11. Furuya Y, Ishihara K, Yamamoto H (2005) Cyanuric chloride as a mild andactive Beckmann rearrangement catalyst. J Am...
- 6
- 591
- 1
Báo cáo hóa học: "A REMARK ON kTH-ORDER LINEAR FUNCTIONAL EQUATIONS WITH CONSTANT COEFFICIENTS" pdf
... WITH CONSTANT COEFFICIENTSJITKA LAITOCHOV´ A Received 30 January 2006; Accepted 18 May 2006Abel functional equations are associated to a linear homogeneous functional equationwith constant coefficients. ... Laitochov´ a: Mathematical Department, Faculty of Education, Palack´y University,ˇZiˇzkovo n´amˇesti 5, Olomouc 77140, Czech RepublicE-mail address: jitka.laitochova@upol.czJitka Laitochov´ a3 Theorem ... Kuczma, Functional Equations in a Single Variable, Monografie Matematyczne, vol. 46,Pa´nstwowe Wydawnictwo Naukowe, Warsaw, 1968.[4] M. Kuczma, B. Choczewski, and R. Ger, Iterative Functional...
- 8
- 331
- 0
Từ khóa: bao cao hoa bai phan tich dinh tinh cac nguyên tố trong một hợp chat huu coa robust adaptive nonlinear control approach to missile autopilot designbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ