Báo cáo hóa học: " Advancing donor management research: design and implementation of a large, randomized, placebo-controlled trial" pot

báo cáo hóa học: " The Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputation" ppt

báo cáo hóa học: " The Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputation" ppt

... BL and IA performed the statistical analysis. BL and AJ drafted the paper and IA critically revised it for important intellectual content. All authors read and gave approval of the final manuscript. Additional ... interests The authors declare that they have no competing interests. Authors' contributions BL, HIA, AJ and IA conceived of and designed the study. BL, AJ and...
Ngày tải lên : 18/06/2014, 18:20
  • 9
  • 597
  • 0
Báo cáo hóa học: " Associations between disease severity, coping and dimensions of health-related quality of life in patients admitted for elective coronary angiography – a cross sectional study" pdf

Báo cáo hóa học: " Associations between disease severity, coping and dimensions of health-related quality of life in patients admitted for elective coronary angiography – a cross sectional study" pdf

... statistical analysis and in drafting the manuscript, ON coordinated the study at the hospital and participated in data collection, and in drafting the manuscript, BRH and AKW participated in planning and ... biological variables and the patient's perceived symptoms (Table 3). As shown in this table, we found a significant and appre- ciable association between angiographic...
Ngày tải lên : 18/06/2014, 22:20
  • 12
  • 463
  • 0
báo cáo hóa học: " Managing variability in the summary and comparison of gait data" pot

báo cáo hóa học: " Managing variability in the summary and comparison of gait data" pot

... averages [41] may also amplify the apparent variability in gait data. Clinical significance of variability The magnitude of variability and its alteration bears sig- nificant clinical value, having been ... demonstrated that typical location and spread estimators used in quantitative gait data anal- ysis, i.e. mean and variance, are highly susceptible to small quantities of contam...
Ngày tải lên : 19/06/2014, 10:20
  • 20
  • 552
  • 0
báo cáo hóa học:" Percutaneous endoscopic lumbar discectomy: clinical and quality of life outcomes with a minimum 2 year follow-up" doc

báo cáo hóa học:" Percutaneous endoscopic lumbar discectomy: clinical and quality of life outcomes with a minimum 2 year follow-up" doc

... in NASS and VAS scores at 6 months and 2 years postoperation compared to preopera- tion. Thus back pain and neurogenic symptoms are partic- ularly disabling and are associated with significant morbidity ... and Pain Visual Analogue Scale (VAS) and return to work. Results: The mean age was 35.6 years, the mean operative time was 55.8 minutes and the mean length of follow-up was...
Ngày tải lên : 20/06/2014, 01:20
  • 8
  • 583
  • 0
Báo cáo hóa học: " Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes" potx

Báo cáo hóa học: " Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes" potx

... TGTGCCGCTAGAGGTGAAATT 60 1.86 As 18S Rev GCAAATGCTTTCGCTTTCG As ISG15 Fwd CTGAAAAACGAAAAGGGCCA 100 1.83 As ISG15 Rev GCAGGGACTCCCTCCTTGTT As STAT1 Fwd TGTCTGTTGGCTCAGTTGCG 100 1.82 As STAT1 Rev GAAATTGATGCTGTGGCGTCT As ... the NBISA01 haemagglutinations in the present study, the level of IFN-α appeared to have a transient biphasic peak at 1 and 3 days post-haemagglutination. Both the UV...
Ngày tải lên : 20/06/2014, 01:20
  • 12
  • 391
  • 0
Báo cáo hóa học: " Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance" doc

Báo cáo hóa học: " Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance" doc

... GGTACCAAGCTT TCAGCTATGTCTTCCCCTGCCTCTCCAT NP 5' NP bac TTTCAGAATTC AGTGCCTCAAAGGAAATAAAATCCTTTTTGTGGACACAATCTTTGAGGAG GGAATTATCTGGTTAC NP 3' NP bac GGTACCAAGCTT TCAGTTACAGAACGACTCTAGGTGTCGATGT Note. ... TTTCAGAATTCGGATCCACCAGTCTTTATAAAGGGGTTTAT GP1 3' GP1 bac GGTACCAAGCTT TCAGTCATAGCAATCTTCTACTAATATAAATATCTCT GP2 5' GP2 bac TTTCAGAATTCGGATCC GGCACATTCACATGGACACTG GP2 3&apo...
Ngày tải lên : 20/06/2014, 01:20
  • 14
  • 411
  • 0
báo cáo hóa học:" Combination therapy: the next opportunity and challenge of medicine" potx

báo cáo hóa học:" Combination therapy: the next opportunity and challenge of medicine" potx

... information is available at the end of the article Ascierto and Marincola Journal of Translational Medicine 2011, 9:115 http://www.translational-medicine.com/content/9/1/115 © 2011 Ascierto and Mari ... Shannon K, Harrigan PR, Hogg RS, Daly P, Kendall P: Association of highly active antiretroviral therapy coverage, population viral load, and yearly new HIV diagnoses in British Col...
Ngày tải lên : 20/06/2014, 04:20
  • 3
  • 338
  • 0
báo cáo hóa học:"Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" docx

báo cáo hóa học:"Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" docx

... represents an analytical challenge as there is no general analytical strategy availa- ble that is capable of identifying membrane and core pro- teins, low and high abundant proteins equally well. Therefore, ... sequences in FASTA format were organ- ized and loaded onto the in-house Mascot primary sequence database. All MS data was also searched against the MSDB database, a composite...
Ngày tải lên : 20/06/2014, 04:20
  • 16
  • 455
  • 0
báo cáo hóa học:" Measuring outcomes in allergic rhinitis: psychometric characteristics of a Spanish version of the congestion quantifier seven-item test (CQ7)" pdf

báo cáo hóa học:" Measuring outcomes in allergic rhinitis: psychometric characteristics of a Spanish version of the congestion quantifier seven-item test (CQ7)" pdf

... Barcleona, Spain; Michael Herdman, Lola Sanz, Josep-Mar a Manresa, Insight Consulting & Research, Barcelona, Spain; Mar a José Rosales, Medical Affairs, Schering-Plough, Madrid, Spain; Vanesa González, ... Hospital Vall de Hebrón, Barcelona, Spain; Ramona Soler, Allergology Department, Hospital Son Dureta, Palma de Mallor ca, Spain; Mª Teresa Audicana, Allergy Service, Hospital de Santi...
Ngày tải lên : 20/06/2014, 15:20
  • 5
  • 361
  • 0
Báo cáo hóa học: " Graphitic carbon growth on crystalline and amorphous oxide substrates using molecular beam epitaxy" pot

Báo cáo hóa học: " Graphitic carbon growth on crystalline and amorphous oxide substrates using molecular beam epitaxy" pot

... SiO 2 )and0 .089nm(onEagle 2000™ glass).Notably,theR a of NCG on Eagle 2000™ glass is almost the same as that of the substrate itself which is famous for surface flatness. Figure 3 Raman spectra of ... degree of crys- tallinity is formed on SiO 2 . The Raman spectra are simi- lar to the best data from NCG on sapphire [8]: the sharp and large D peak and the clear 2D peak. Notabl...
Ngày tải lên : 20/06/2014, 22:20
  • 6
  • 320
  • 0

Xem thêm

Từ khóa: