Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot
Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot
... d at the same chamber usingalternating surface-saturating reactions of titanium chlo ride and water. The TiOPDA-TiO2nanohybrid thin films that were prepared exhibit good thermal and mechanical ... USA) using A l Kasource run at 15 kV and 10 mA. The binding energyscale was calibrated to 284.5 eV for the main C 1s peak.Each sample was analyzed at a 90° angle relative to theelectron analyzer. ... Minnesota: Physical Electronics, Inc.; 1995.doi:10.1186/1556-276X-7-71Cite this article as: Yoon et al.: Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium...
- 6
- 359
- 0
báo cáo hóa học:" Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" ppt
... of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetyleneKwan-Hyuck Yoon, Kyu-Seok Han and Myung-Mo Sung*AbstractWe fabricated a new organic-inorganic ... d at the same chamber usingalternating surface-saturating reactions of titanium chlo ride and water. The TiOPDA-TiO2nanohybrid thin films that were prepared exhibit good thermal and mechanical ... deposited atthe same temperatures with alternating surface-saturating reactions of titanium tetrachloride and water.Ellipsometry analysis showed a self-limiting surface reaction process and linear...
- 6
- 292
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are expressed as mean ± standard deviation (SD), and P < 0.05 is considered to be statistically significantwith...
- 11
- 396
- 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... gene was amplified by PCR, with chromosomalDNA of M. mazei as template and the following primers:mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAAATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev,5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCATTTTTTGC-3¢.The ... Shima S, Netrusov A, Sordel M, Wicke M, HartmannGC & Thauer RK (1999) Purification, characterization, and primary structure of a monofunctional catalase fromMethanosarcina barkeri. Arch ... Brioukhanov A, Netrusov A, Sordel M, Thauer RK &Shima S (2000) Protection of Methanosarcina barkeriagainst oxidative stress: identification and characteriza-tion of an iron superoxide dismutase....
- 10
- 539
- 0
Báo cáo hóa học: " Research Article A New System of Generalized Nonlinear Mixed Variational Inclusions in Banach Spaces" pot
... of variational inequality problems, were introduced and studied. Pang 1, Cohen and Chaplais2, Bianchi 3, and Ansari and Yao 4 considered a system of scalar variational inequalities, and Pang ... Mathematicae Debrecen, vol. 54, pp. 267–279, 1999.8 G. Kassay, J. Kolumb´an, and Z. P´ales, “Factorization of Minty and Stampacchia variational inequalitysystems,” European Journal of ... and ApplicationsMinty and Stampacchia variational inequality systems with the help of the Kakutani-Fan-Glicksberg fixed point theorem. Peng 9, Peng and Yang 10 introduced a system of quasivariational...
- 15
- 232
- 0
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx
... Integral means inequalities for fractional derivativeWe will make use of the following definitions of fractional derivatives by Owa 4,andSrivas-tava and Owa 5.Definition 4.1. The fractional ... comments and suggestions.References1 F. M. Al-Oboudi, “On univalent functions defined by a generalized S˘al˘agean operator,” InternationalJournal of Mathematics and Mathematical Sciences, ... 53–59, 1978.5 H. M. Srivastava and S. Owa, Eds., Univalent Functions, Fractional Calculus, and Their Applications, EllisHorwood Series: Mathematics and Its Applications, Ellis Horwood, Chichester,...
- 10
- 253
- 0
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Defined by Generalized Ruscheweyh Differential Operator" potx
... Journal, vol. 18, no. 1, pp. 53–59, 1978.4 H. M. Srivastava and S. Owa, Eds., Univalent Functions, Fractional Calculus, and Their Applications, EllisHorwood Series in Mathematics and Its Applications, ... Journal of Inequalities and ApplicationsReferences1 K. A. Shaqsi and M. Darus, “On univalent functions with respect to K-symmetric points given by a generalised Ruscheweyh derivatives operator,” ... pagesdoi:10.1155/2008/134932Research Article A New Subclass of Analytic Functions Defined byGeneralized Ruscheweyh Differential OperatorSerap BulutCivil Aviation College, Kocaeli University, Arslanbey Campus, 41285˙Izmit-Kocaeli,...
- 12
- 251
- 0
Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf
... parameters,” Advances inMathematics, vol. 38, no. 3, pp. 257–268, 2009.5 B. C. Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, ... Mitrinovi´c, J. E. Peˇcari´c,andA.M.Fink,Inequalities Involving Functions and Their Integrals and Derivatives,vol.53ofMathematics and Its Applications (East European Series),KluwerAcademicPublishers, ... constant factor π is the best possible. Zeng and Xie 11 also give a new inequalityin the whole plane.By applying the method of 10, 11 and using the way of real and complex analysis,the main...
- 11
- 386
- 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS 2837GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGACGATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTCCTGAAATCATCAAGTTATTGAGATCGTCG-3¢, respec-tively ... including a catalytic triad, an a ⁄ b-hydrolase fold and a cofactor independent activity.The catalytic triad usually consists of a nucleophilicserine in a GXSXG pentapeptide motif and an acidicresidue ... hydrolysis of an ester bondresulting in the formation of an alcohol and a carboxy-lic acid. Both types of enzymes belong to the family of serine hydrolases and share structural and functionalcharacteristics,...
- 11
- 460
- 0
Báo cáo hóa học: " Research Article A New Hybrid Algorithm for a System of Mixed Equilibrium Problems, Fixed Point Problems for Nonexpansive Semigroup, and Variational Inclusion Problem" ppt
... Cholamjiak and S. Suantai, A new hybrid algorithm for variational inclusions, generalizedequilibrium problems, and a finite family of quasi-nonexpansive mappings,” Fixed Point Theory and Applications, ... Theory and Applications9 T. Jitpeera and P. Kumam, “An extra gradient type method for a system of equilibrium problems,variational inequality problems and fixed points of finitely many nonexpansive ... Journal of Inequalities and Applications, vol.2010, Article ID 728028, 43 pages, 2010.13 C. Jaiboon, W. Chantarangsi, and P. Kumam, A convergence theorem based on a hybrid relaxedextragradient...
- 27
- 408
- 0
Từ khóa: các báo cáo toán học haybáo cáo toán học haybáo cáo khoa học toán họcbáo cáo khoa họcbáo cáo y họcbáo cáo môn họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP