báo cáo hóa học:" Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" pptx

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

... Central Page 1 of 9 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research Dental pain, oral impacts and perceived need for dental treatment in Tanzanian ... untreated dental caries, oral impacts on daily performances and perceived need for dental care. Dental pain and reported oral problems varied sys...
Ngày tải lên : 18/06/2014, 19:20
  • 9
  • 442
  • 0
báo cáo hóa học:" Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" pptx

báo cáo hóa học:" Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" pptx

... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den- tal pain and dental problems. In this table a Adjusted for age, ... be a reliable and valid instrument when applied to children in numer- ous countries, such as Thailand, France, UK and Tanzania [5-8]. Untreated dental caries might l...
Ngày tải lên : 20/06/2014, 16:20
  • 9
  • 383
  • 0
báo cáo hóa học: "Effect of step-synchronized vibration stimulation of soles on gait in Parkinson''''s disease: a pilot study" doc

báo cáo hóa học: "Effect of step-synchronized vibration stimulation of soles on gait in Parkinson''''s disease: a pilot study" doc

... caused by a dopamine defi- ciency in the basal ganglia that results in characteristic motor abnormalities including postural instability and gait impairment. Short shuffling steps, slow walking speed, ... walking speed, and increased stride variability characterize abnor- mal gait in PD. Although PD is primarily a motor disease, accumulating evidence suggests that abnormal propr...
Ngày tải lên : 19/06/2014, 10:20
  • 7
  • 497
  • 0
báo cáo hóa học: " Efficient reengineering of meso-scale topologies for functional networks in biomedical applications Andreas A Schuppert" pptx

báo cáo hóa học: " Efficient reengineering of meso-scale topologies for functional networks in biomedical applications Andreas A Schuppert" pptx

... computational performance. Combinatorial stimulation-inhibition analysis using a direct functional reengineer- ing approach can aid in rapidly unravelling stable information about the coarse- grained ... p and Q-values, stimuli can be classified as either inactive or dominant. Inactive stimuli may display a mean p-value less than 0.05 and a negative Q-value whereas dominant stimuli...
Ngày tải lên : 21/06/2014, 02:20
  • 20
  • 322
  • 0
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG- Journal of Translational Medicine 2009, 7:43 http://www.translational-medicine.com/content/7/1/43 Page ... ACGCCGTCCTTT- GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA; CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D, CTCCGTGGTTTGAACACGAAA. The sequences used in HT-R...
Ngày tải lên : 18/06/2014, 15:20
  • 12
  • 348
  • 0
báo cáo hóa học:" Higher percentage of CD133+ cells is associated with poor prognosis in colon carcinoma patients with stage IIIB" pptx

báo cáo hóa học:" Higher percentage of CD133+ cells is associated with poor prognosis in colon carcinoma patients with stage IIIB" pptx

... immunohisto- chemical staining work, LBX and ZXF analyzed results. ZXS and ZYX conceived of the study, participated in its design and coordination and helped to draft the manu- script. All authors read and approved ... CPT-11 and oxaliplatin and monoclonal antibod- ies against EGFR (cetuximab and panitumumab) and VEGF (bevacizumab), the 5-year survival is still pessimis- t...
Ngày tải lên : 18/06/2014, 15:20
  • 8
  • 550
  • 0
báo cáo hóa học: " Health-related quality of life of patients following selected types of lumbar spinal surgery: A pilot study" ppt

báo cáo hóa học: " Health-related quality of life of patients following selected types of lumbar spinal surgery: A pilot study" ppt

... healing. Symptoms: pain and mood The primary complaints of patients undergoing lumbar spinal surgery are back pain and radicular pain accompa- nied by leg weakness. The goal of spinal surgery is to ... reliabilities may be low due to a change in the patients' health after surgery as well as a three-month period between test administrations. Data analysis Data was entered into t...
Ngày tải lên : 18/06/2014, 22:20
  • 11
  • 332
  • 0
báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

... study, analyzed and interpreted the data and drafted the manuscript. RD and MBH contributed to the design and interpretation of the analysis. All authors read and critically revised and approved ... response to individual items comprising that subscale; the subscales are then standardized using a z-score trans- formation and aggregated to estimate the aggregated physical and...
Ngày tải lên : 18/06/2014, 22:20
  • 7
  • 366
  • 1
Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt

Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt

... hyperkeratosis and acanthosis with occasional ulcerative change, and an increase of the mitotic index of the skin cells. Also cadmium concentration in blood, liver and kidney increased, thus indicating ... μg cadmium; 95% of this taken up with food and drinks. An average smoker has an additional intake of 30 μg per day [4]. Several factors can increase this amount, such as low intak...
Ngày tải lên : 20/06/2014, 00:20
  • 6
  • 736
  • 0
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx

Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx

... AGGCCTTCCCGAGAAAGTGCTTAGCCTTGTTGATGATCCAAGGAACCACAT AGAGAACCAAGACGAGTGC KIAA0220 Hs.110613 70 1121 416 82.4 60.0 CS TGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAA CCGTCACGCAAACCCAAGAG CLU Hs.75106 ... CS GTAGCTGCCTGCATAGGAGCCTCGCTTCCGATTATTCCCTTCCCAATATTAT TCATCCAGACTTAGCCAC KARS Hs.3100 70 1997 142 73.6 38.6 CS GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA AAMP...
Ngày tải lên : 20/06/2014, 01:20
  • 15
  • 426
  • 0

Xem thêm

Từ khóa: