Báo cáo hóa học: " HIV-1 designed to use different tRNAGln isoacceptors prefers to select tRNAThr for replication" ppt
Báo cáo hóa học: "Epigenetic change in E-Cardherin and COX-2 to predict chronic periodontitis" pptx
... in cancer initiation [34].Although the effect of IL-6 to cancer is s till unknown,this cytokine may provide a link from bacterial infection to inflammation and cancer. Changes and damages in cells ... 8:110http://www.translational-medicine.com/content/8/1/110Page 5 of 6RESEARC H Open AccessEpigenetic change in E-Cardherin and COX-2 to predict chronic periodontitisWings TY Loo1*, Lijian Jin1, Mary NB Cheung2, Min ... of E-Cadherin and cytokeratin 19 and net proliferative rate of gingival keratinocytes in oral epithelium in periodontal health and disease. J Periodontol 2007, 78:2197-202.10. Irwin C, Mullally...
- 6
- 422
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
... social support and sense of coherence on health-related quality of life among nursing home residents – a questionnaire survey in Bergen, Norway. International Jour-nal of Nursing Studies in press. ... defined mentally intact as having a Clinical DementiaRating (CDR) ≤ 0.5 [22], which was assessed by trainednurses who knew the residents well. In this context, weclassified CDR as: mentally intact ... CentralPage 1 of 9(page number not for citation purposes)Health and Quality of Life OutcomesOpen AccessResearch Sense of coherence as a resource in relation to health-related quality of life...
- 9
- 844
- 0
Báo cáo hóa học: " Beyond satisfaction: Using the Dynamics of Care assessment to better understand patients'''' experiences in care" pptx
... analysis of the Dynamics of Care We conducted a series of analyses on the Dynamics of Care assessment to better understand the psychometricTable 3: Rates of Selection of Areas to Probe in Dynamics of ... perceptions of experiences in care, the Dynamics of Care (DoC) assessment. It is an in- depth approach to defining and assessing patients' perspectives at differentjunctures in care, including their ... episode of care, includingtheir decision whether and where to seek care, the barriersthey encountered, and the treatments and services theyreceived. The Dynamics of Care is an interviewer adminis-tered...
- 20
- 551
- 0
Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf
... 8:13http://www.jneuroengrehab.com/content/8/1/13Page 7 of 8RESEARC H Open Access Complexity of VTA DA neural activities in response to PFC transection in nicotine treated ratsTing Y Chen, Die Zhang, Andrei Dragomir, Yasemin M Akay, Metin Akay*AbstractBackground: ... the complexity of firing of the VTA DA neuron and thisalteration should be based on the intact input fromother brain areas. Since PFC is the main source of exci-tatory inputs to the VTA, the effect of nicotine ... to use thisnonlinear dynamical analysis method, based on the LZ complexity method, to gain insights into the VTA DA neuronal activity induced by systemic administration of nicotine to both PFC...
- 8
- 403
- 0
báo cáo hóa học: " Knowledge discovery in databases of biomechanical variables: application to the sit to stand motor task" docx
... The kinematics of, and the dynamic actionson, the CM of the modelled portion of the body involved in the movement are needed as model inputs. The outputs of the TIPs are the kinematic and kinetic ... values, showing a high level of repeatability of the timing of the performance of the task.Conclusions: The distinctive patterns of the sit -to- stand task found in this study, associated to those ... amount of data stored in adatabase. The sit -to- stand motor task was already shown to be adequate for determining the level of individual motor ability.Methods: The technique of search for association...
- 10
- 380
- 0
báo cáo hóa học: " Effects of the physiological parameters on the signal-to-noise ratio of single myoelectric channel" doc
... a contraction. The major findings include:1. The SNR of a single ME channel is highly related to the stimulus intensity of the motoneuron, which carries the information of the voluntary contraction ... a contraction [18-20].Some modelling work on motoneuron firing patterns sug-gested that the range of the firing rate of the motoneuronduring a steady contraction is 8 to 50 pps [21]. On the other ... investigates the effects of physiological factors on the SNR of single ME channel by an analytical and simulationapproach, where the SNR is defined as the ratio of the mean squared value estimation at the channel...
- 10
- 387
- 0
báo cáo hóa học: " Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" doc
... otherclinically defined PD groups.DiscussionOur finding of an overall correlation between aSN depo-sition and MHCII-expressing microglia in the substantia nigra is in line with the finding ... NeuroinflammationOpen AccessResearch Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein depositionEmilie Croisier1, LindaBMoran1, David T Dexter2, Ronald ... in humans [14]. In the present study, we independently evaluate the sever-ity of alpha-synuclein deposition and microglial activa-tion identified by immunohistochemical staining in the SN in a large...
- 8
- 403
- 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc
... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 betaReverse TGAGTCACAGAGGATGGGCTCIL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6Reverse AAGTGCATCATCGTTGTTCATACAIL-12 ... TGTACAGAGCTCCACGGCTGCiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivatorReverse ACGCCAGTCTGACGAAGGTCCACOX-2 Forward CAGACAACATAAACTGCGCCTT ... werecalculated using the levels found in SJL/J explants as the standard. Transcripts for many pro-inflammatory media-tors and antisecretory factor revealed differential tissuelevels among strains...
- 8
- 447
- 0
báo cáo hóa học: " Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b" pot
... article as: Kauppinen et al.: Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b. Journal ofNeuroinflammation 2011 8:152.Submit your next manuscript to BioMed Centraland take ... comparisons (Table 3).PARP-1 modulates microglial trophic factor releaseActivated microg lia can also release, in addition to neu-rotoxic agents, several cytokines and trophic factors thatcan promote ... attenuatesAb-induced microglial activation and microglial neuro-toxicity. PARP-1 inhibitors are entering clinical use forother conditions, and compounds such as minocyclinewith potent PARP-1 inhibitory effects...
- 17
- 224
- 0
báo cáo hóa học: " Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide" ppt
... made available soon. Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharideJournal of Neuroinflammation ... activation of the innate immune system of the brain which is tempered by GPE (Fig. 5). Decreased neuroinflammation in response to IGF-I Figure 31 Insulin-like growth factor-I peptides act ... Figure 31 Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide Sook-Eun Park1,2,4, Marcus...
- 38
- 340
- 0
Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot
... AccessResearch Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional studyMir Saeed Attarchi*1, Omid Aminian2, Mandana Dolati3 and ... of Health & Medical Education, Tehran, IranEmail: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Mandana Dolati - mandanadolati@yahoo.com; Maria Mazaheri ... to VCM [1].VCM is hepatotoxic and carcinogenic and can cause liver damages such as hepatic fibrosis, hepatic angiosarcoma,hepatocellular carcinoma, portal hypertension, etc.The mechanism of...
- 6
- 380
- 0
Báo cáo hóa học: "Assessment of nutritional knowledge in female athletes susceptible to the Female Athlete Triad syndrome" pot
... AbstractBackground: The study aimed to i) assess nutritional knowledge in female athletes susceptible to the Female Athlete Triad (FAT) syndrome and to compare with controls; and ii) to compare nutritional knowledge ... observable in the young female non -athlete population. In terms of intervention, if optimising performance is the dominant factor in motivating the female athlete, imple-mentation of sound nutritional ... osteoporosis).Number of cases in each component of the Female Athlete Triad for athletes (nA = 59) and controls (nC = 32)Figure 2Number of cases in each component of the Female Athlete Triad for athletes...
- 11
- 475
- 0
Báo cáo hóa học: " HIV-1 designed to use different tRNAGln isoacceptors prefers to select tRNAThr for replication" ppt
... that use reverseBioMed CentralPage 1 of 7(page number not for citation purposes)Virology JournalOpen AccessResearch HIV-1 designed to use different tRNAGln isoacceptors prefers to select ... preferred by HIV-1 for replication indi-cating that HIV-1 prefers tRNAThr as a primer for replica-tion.The results of our study re-enforces the idea that HIV-1 haspreferences for the selection ... complementary to the 3' terminal nucleotides of the primer tRNA used for initiation [3]. HIV-1 specifically selects tRNALys,3 from theintracellular milieu to be used as the primer for initiationof...
- 7
- 246
- 0
Báo cáo hóa học: " CT angiography predicts use of tertiary interventional services in acute ischemic stroke patients" pptx
... Thomas et al.: CT angiography predicts use of tertiary interventional services in acute ischemic stroke patient s.International Journal of Emergency Medicine 2011 4:62.Thomas et al. International ... al. International Journal of Emergency Medicine 2011, 4:62http://www.intjem.com/content/4/1/62Page 6 of 7ORIGINAL RESEARCH Open Access CT angiography predicts use of tertiary interventional services ... controlling for the initial NIH stroke scale (NIHSS) score, proximal occlusion remained an independentpredictor of the use of neurointerventional services (OR 8.5, 95% CI 2.2-33). Evidence of proximal...
- 7
- 260
- 0
Báo cáo hóa học: " Integrating a Trust Framework with a Distributed Certificate Validation Scheme for MANETs" ppt
... to any weak inter-pretation of trust. In our case, ATF acts as the trust plane and ADOPT as a trust- aware application. When integrating the ATF trust plane with the ADOPT scheme, several performance ... ayerNetwork layerLink layerPhysical layer (a) TApplication layerTTransport layerTNetwork layerTLink layerTPhysical layer Trust planeTApplication layerTTransport layerTNetwork layerTLink layerTPhysical ... one. Alternatively it cankeep only aged responses that, for example, make a currentlyrevoked certificate appear as valid. Actually, such responsesare valid, but o ut-of-date. In any case, a ClientNode...
- 18
- 183
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam