Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf
... havebeen associated with all of the past influenza pandemics[4,5]. Influenza A viruses are classified into subtypes accordingto the hemagglutinin (HA) and neuraminidase (NA) glyc-oproteins that are ... repeat the assay because our RNA stock of those2 samples was exhausted. The fact that there was no virusisolated for those samples does not necessarily explain the lack of amplification, as ... of the 9 NA subtypes. We are the first todesign a primer set for a one-step RT -PCR assay of multi-ple influenza A viruses that can amplify all 9 NA subtypes simultaneously from a range of host...
- 11
- 378
- 0
Báo cáo hóa học: " Research Article Regularity Criterion for Weak Solutions to the Navier-Stokes Equations in Terms of the Gradient of the Pressure" docx
... Chen and X. Zhu, A note on BMO and its application,” Journal of Mathematical Analysis andApplications, vol. 303, no. 2, pp. 696–698, 2005.18 H. Kozono and H. Wadade, “Remarks on Gagliardo-Nirenberg ... regularity of weak solutions of the Navier-Stokes equations,” Archive forRational Mechanics and Analysis, vol. 9, no. 1, pp. 187–195, 1962.3 T. Ohyama, “Interior regularity of weak solutions of ... Proceedings of the American Mathematical Society, vol. 135, no. 6, pp. 1829–1837, 2007.13 J. Fan, S. Jiang, and G. Ni, “On regularity criteria for the n-dimensional Navier-Stokes equations interms of...
- 6
- 435
- 0
Báo cáo hóa học: "Research Article Spectrum Sharing in an ISM Band: Outage Performance of a Hybrid DS/FH Spread Spectrum System with Beamforming" docx
... modelhaving a flat mainlobe and a flat sidelobe is developed. The width of the mainlobe and the height of the sidelobeare calculated based on the first moment and the secondmoment of the real beam ... (17)4.2. Partial-Band Interference. Partial-band interferersoccupy part of the hoped bandwidth. A partial-bandinterferer to a DS/FH signal is the same as a partial-bandjammer to a spread spectrum ... spectraland spatial characterization of the system and assume all the users and interferences are present in the band where the firstuser is active. The temporal characterization of the systemand interferences...
- 11
- 348
- 0
báo cáo hóa học:" GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment" pptx
... Exon1 and flanking introns by PCR/ sequencing. The PCR primers used are forwardprimer:5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3'and reverse primer 5'GGGGCTGGACCAACACACGTC-CTT GGG3'. ... forward primer5'TTGGTGTTTGCTCAGGAAGA 3' and reverse primer5'GGCCTACAGGGGTTTCAAAT 3'. Among this studycohort, 851 patients from central China were also ana-lyzed for mutations ... Wu's opinion to reassignment of p. V37I from anallele variant to a pathogenic mutation [38]. The p.T123N is an unclassified variant. It was counted as a mutation in Japanese group but a...
- 12
- 507
- 0
Báo cáo hóa học: " Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics" ppt
... involvement of other modifierfactors in the phenotypic manifestation of these putativedeafness-associated 12S rRNA variants, as in the case of these families carryin g the 155 5A > G mutation [39].Further ... the presence o fmtDNA variants were o btained from a panel of unaf-fected Han Chinese subjects from the same region.Mutational analysis of mitochondrial 12S rRNA gene Genomic DNA was isolated ... evaluated by structural andphylogenetic analysis.Results: The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the...
- 11
- 616
- 0
Báo cáo hóa học: " Robot-aided therapy for upper limbs in patients with stroke-related lesions. Brief report of a clinical experience" ppt
... Rehabilitation NOCSAE Hospital AUSL of Modena, Modena, ItalyFull list of author information is available at the end of the articleBovolenta et al. Journal of NeuroEngineering and Rehabilitation ... processed the data. VDAperformed the statistical analysis. FB, PS, and VDA wrote the manuscript. Allauthors read and approved the manuscript.Competing interests The authors declare that they have ... to the start of the rehabilitation. With the exception of the Medical Research Council (MRC) and the AS sub-scales measuring -asappropriate- strength and spasticity of the shoulder, triceps and...
- 6
- 612
- 0
báo cáo hóa học: " Soluble HLA measurement in saliva and cerebrospinal fluid in Caucasian patients with multiple sclerosis: a preliminary study" pdf
... additional hour at45°C. After additional washes, the color reaction wasstarted by adding the appropriate substrate. Absorbancewas measured at 492 nm.Each assay included a standard curve derived from ... resultsindicate that measurement of saliva sHLA-II may be a potential noninvasive biological marker of disease activityin a primary CNS disease such as MS.Competing interests The author(s) declare that ... nohistory of autoimmune disease for the purpose of com-parison. Because there is a high degree of racial variationin the gene frequencies of HLA [7], we limited study par-ticipation to Caucasians...
- 7
- 326
- 0
báo cáo hóa học: " Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience" pptx
... few cases are reported each year. Incountries like Thailand and Malaysia only a handful of mesotheliomas have been identified, and in Taiwan, lessthan 10 cases of mesothelioma (387 cases from ... is that of the gender and age adjusted general popu-lation. Another reference risk could be the archaic risk of cancer, e.g. the estimated or a ssumed age and gen-der-adjusted risk of cancer ... publications that account for latencyor that present the data in a way that permits physiciansto apply the dose-response data and account for latencyat the same time.Reference articles High quality...
- 10
- 390
- 0
báo cáo hóa học: " Tobacco smoke particles and indoor air quality (ToPIQ) - the protocol of a new study" potx
... ML, Pham L, McDermott A, Zeger SL, Samet JM: Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases. Jama-Journal of the American Medical Association ... to the conception and design of the review, acquisition of the review data and have been involved in drafting and revising the manuscript. All authors have read and approved the final manuscript. ... Diez-Roux AV, Holguin F, Hong YL, Luepker RV, Mittleman MA, et al: Particulate Matter Air Pollution and Cardiovascular Disease An Update to the Scientific Statement From the American Heart Association....
- 18
- 462
- 0
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... located in8~26 ACCTCTGCCTAATCATCTC X/preC40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein1450~1469 ... defined as sites within the desired locationsthat had 17+ bases from the 3' end and with a frequency of 0.90+ in the BxB. The output of BxB analysis was desig-nated as a FASTA format, which ... CCTGCTGGTGGCTCCAGTTC pre-S21571~1592 TCCTAGGACCCCTGCTCGTGTT S1657~1679 ACTTCTCTCAATTTTCTAGGGGG S2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT RT3199~3221 CACCAGCACCATGCAACTTTTT...
- 7
- 566
- 0
Từ khóa: báo cáo khoa họcbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP