báo cáo hóa học:" Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study" pdf
báo cáo hóa học:" Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study" pdf
... AccessResearch Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional studyCathrine Haugene Ljoså* and Bjørn LauAddress: National ... citation purposes) with having enough time to be with friends and to main-tain adequate social relations. Further, wishful thinking as a coping strategy was associated with problems in social and ... social and family life might ameliorate any potentially negative impact in these areas. It is fairly well established that, whether or notactual control is available and can be executed, the...
- 10
- 409
- 0
báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf
... studies in youngadult animals also demonstrate that DE elevates pro-inflammatory factors in the brain, using a month-longinhalation models [18,28], in tratracheal administrationdirectly into the ... IL-1β: Interleukin 1 beta; IL-6: Interleukin 6; MIP-1α:Macrophage inflammatory protein 1 alpha; NAAQS: National Ambient AirQuality Standards; A : Beta Amyloid; FTD: Frontotemporal dementia.AcknowledgementsMLB, ... sen-sitivity to DE in the midbrain generalized to other pro-inflammatory markers. IL-1b is another pro-inflamma-tory factor elevated in PD and AD that has been widelyimplicated in neuronal damage [50]....
- 10
- 375
- 0
báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx
... deficits and rotarod performance. AGF and MGC performed the calculation of the infarct volumes and participated in the statistical analysis of the data. OSL, EM and BLF partici-pated in the design and coordination ... brain section wasdefined as infarcted. Cortical and subcortical uncorrectedinfarcted areas and total hemispheric areas were calcu-lated separately for each coronal slice. Total cortical and subcortical ... performance at 24 h afterpermanent focal cerebral ischemia, animals were sacri-ficed and the brains were removed to calculate the infarctsize.Data analysisData are presented as means ± S.D. Values...
- 11
- 568
- 0
Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx
... all the plant work. PAR and PC did the RNA extractions, labeling and microarray hybridizations.MAPA analyzed the microarray data and supervisedmicroarray work. JC, GR and AJ developed the algorithm and ... deprivation and ABA-mediated signaling share six genes. Three ofthem were ABA-activated transcription factors(At4g34000, At2g46680 and At1g45249), At4g33950 is anABA-activated protein kinase whose activity ... microarray hybridizationTotal RNA was extracted from control (mock inoculated) and systemic infected plants, and used in an amplificationreaction with the MessageAmp II aRNA Amplification kit(Ambion)...
- 11
- 436
- 0
Báo cáo hóa học: " Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda" docx
... AF364055GCCCCTGCCATTTGAAAAAT TCGCGAATGCAGTAGCACTGrep4 AY499565CGGCGTGTCACAAACTGTTG GCTTCAAGATGTTGCCCCATTrep5 AY499566GGAAGACCGCCTGCTTATCA CCTCCGAATAAAGGCGTCAGTrep6 AY499567AAGGCCAGAAGAAGATCGCC AGAGGCATGAGCCAGTCCCrep7 ... AF479654GGGTCGCAATGAAGGTGCTA CTGGCGAGTGTGTTTGCAATH. didymator18S RNA AY433942CATCGTGGTGCTCTTCATTGA CAAAGTAAACGTACCGGCCCS. frugiperdaE2 ubiquitin ligase SF9L03548 (*) ACTTGTGGCCCGCATACACT GGATCGGCACAATAAATGGGRNA ... GATGTTGCCCCATTTCTAGAACCGCAACAG 48°Crep5 AGGGGCCCCACGCGGTAGACGAAACCCACG 54°Crep6 &11 GCCCGCGGAACGTGAAGGTGTCCACCGGGT 50°Crep7 CCTGCGAAATTTCTTGATACACCACAGCCT 47°Crep8 TTCTCGTTGCAGCCCGTGACAGGCGCGAGC 53°CVirology...
- 11
- 352
- 0
báo cáo hóa học:" Decrease in the expression of the type 1 PTH/PTHrP receptor (PTH1R) on chondrocytes in animals with osteoarthritis" potx
... at 3, 6, and 12 weeks. After opening the knee joint, OA was macroscopically graded and hyaline cartilage of the load-bearing area was evaluated histologically according to the Mankin scale and ... histological grading of OA. He carried out the quantitative countingof cells and participated in immunohistochemical staining.SO participated in the statistical analysis and manuscript preparation.AS ... stained with Safranin O or with hematoxylin and eosin (H&E) to evaluate histologicchanges of the cartilage and bone tissue according to the Mankin scale [16]. The Mankin score included assess-ments...
- 6
- 440
- 0
báo cáo hóa học:" Substitutions in the Reverse Transcriptase and Protease Genes of HIV-1 Subtype B in Untreated Individuals and Patients Treated With Antiretroviral Drugs" potx
... of the deamination of a cytosine, leading to the inclusion of anadenosine instead of guanosine in positive-strandedcDNA. This results in mutant viruses that contain severalG A changes. With ... by increas-ing the intracellular ratio of dCTP/dTTP.[27]An alternative important cause of G A hypermutationmay involve a cellular factor, APOBEC3G, a cytidinedeaminase that converts cytosine ... substitutions that causeamino-acid changes in HIV-1 favor a guanosine-to-adeno-sine (G A) transition.[5-8] The G A transition plays animportant role in viral evolution as well as in the escapeof HIV-1...
- 6
- 286
- 0
báo cáo hóa học:" Cancers in the TREAT Asia HIV Observational Database (TAHOD): a retrospective analysis of risk factors" ppt
... South Wales, Sydney, Australia, for co-facilitating the cancer training day and for the development of the TREATAsia Cancer Training manual. The TREAT Asia Observational Database CollaboratorsCV ... Ramathi-bodi Hospital at Mahidol University, Bangkok, Thailand, a collaborating site of the Therapeutics Research, Educa-tion and AIDS Training in Asia (TREAT Asia) HIVObservational D atabase ... Elizabeth Hospital, Hong Kong, China;N Kumarasamy* and S Saghayam and C Ezhilarasi, YRG Centre for AIDSResearch and Education, Chennai, India;S Pujari*†, K Joshi and A Makane, Institute of Infectious...
- 14
- 316
- 0
báo cáo hóa học:" Trends in the clinical characteristics of HIVinfected patients initiating antiretroviral therapy in Kenya, Uganda and Tanzania between 2002 and 2009" pdf
... a cross- sectional analysis of characteristics of HIV-infected adults initiating ART between2002 and 2009 in Kenya, Uganda and Tanzania and in the International Epidemiologic Databases to Evaluate ... than 5% in 2002 to 65% in Kenya,53% in Uganda and 44% in Tanzania by 2009 [3]. Accessto ART has also had a measureable impact on the eco-nomic and social dimensions of life in Africa by increas-ing ... AIDS Care and Education Ser-vices based in Nyanza Provin ce and Nyanza ProvincialHospital. In Uganda, affiliated sites include the Infec-tious Diseases Institute and Mulago Hospital, the Nsam-bya...
- 10
- 392
- 0
Báo cáo khoa học: Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro pot
... [3 0–3 8]. In this study, we analysed several pointsmutants in the C-terminal domain of ALSV IN and examined their ability to mediate the concerted DNAintegration in an in vitro assay as well as ... the formation of this strand as glutamate acts as a strand breaker [61]. Altogether, these data suggest a strongstructural role for the terminal part of the C-terminaldomain of ALSV integrase ... PEG8000 and 50 mMNaCl, and the integration mixture wasincubated at 37 °Cfor90min.Gel analysis of the integration reactionFor gel analysis of the integration reaction, the DNA donorwas radiolabelled...
- 13
- 476
- 0
Từ khóa: role of adenosine in the control of inflammatory events associated with acute and chronic neurodegenerative disordersthe international petroleum industry environmental conservation association ipieca and the international association of oil and gas producers ogp biodiversity working group bdwgbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóabáo cáo tuần sinh hoạt tập thể đầu năm họcquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcviết bài cho báo hoa học trò như thế nàobáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caochuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ