Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx
Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx
... Corresponding author AbstractAims: To analyze the relationship between exposure to chlorinated and aromatic organic solvents and malignant lymphoma in a multi-centre, population-based case-control study. Methods: ... themanuscript and performed the statistical analysis. MMparticipated in the statistical analysis and in drafting themanuscript. JB participated in the coordination of thedata collection and in the ... exposure and malignant lymphoma: a population-based case-control study in GermanyAndreas Seidler*1, Matthias Möhner1, Jürgen Berger2, Birte Mester3,4, Evelin Deeg5, Gine Elsner3, Alexandra...
- 11
- 456
- 0
Báo cáo hóa học: " Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma" potx
... germline and somatic mutations ofthis gene in VHL patients and sporadic RCC. Today, morethan 400 germline mutations have been reported in VHLpatients and about 300 somatic mutations in sporadicRCC ... read and approved the manuscript.AcknowledgementsThe study received funding from the European Chlorinated Solvent Asso-ciation (ECSA) and the Halogenated Solvents Industry Association (HSIA).The ... occupational cancer where there was a molecular analysis of VHL without mutation detected in this gene, suggesting that other genes may be implicated in RCC and in particular linked to chemical exposure...
- 7
- 442
- 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... 2Immunostaining of prostate cancer tissue with antibodies against AMACR and PSA. Surgically resected prostate cancer tissue was immunostained with an anti-AMACR antibody (panel A) or anti-PSA antibody ... granulocyte macrophage colony-stimulat-ing factor (GM-CSF) were kind gifts from Takeda Pharma-ceutical Co. (Osaka, Japan), Ono Pharmaceutical Co.(Osaka, Japan) and Novartis Pharmaceutical ... Zhou M, Dhanasekaran SM, Varambally S, Barrette TR,Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM: alpha-Methylacylcoenzyme A racemase as a tissue biomarker for prostatecancer. Jama 2002, 287:1662-1670.8....
- 11
- 531
- 0
Báo cáo hóa học: " LEF-1 and TCF4 expression correlate inversely with survival in colorectal cancer" pptx
... clinical dataof patients and performed statistical data analysis. AJ and TK coordinatedthe study and were involved in drafting the manuscript and revised itcritically. All authors read and approved ... theleading causes of cancer-related death. Dysregulation and abnormal activation of the Wnt/b-catenin signallingpathway caused by mutations of APC are decisive forthe initiation as well as progression ... Ferrari GV, Kaykas A: WNT and beta-cateninsignalling: diseases and therapies. Nat Rev Genet 2004, 5:691-701.20. Logan CY, Nusse R: The Wnt signaling pathway in development and disease. Annu...
- 8
- 664
- 0
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx
... sensorwas affixed, participants performed 30 s of 'baseline'activities such as blinking, talking, smiling and movingtheir head. Scale-specific thresholds were automaticallyevaluated ... quick and sustained eye-brow raises, eye blinks and head move-ment.JNERJOURNAL OF NEUROENGINEERING AND REHABILITATIONAlves and Chau Journal of NeuroEngineering and Rehabilitation 2010, 7:22http://www.jneuroengrehab.com/content/7/1/22Open ... promote an individual'sindependence and participation in daily living tasks [1].Depending on the user's physical abilities, switchinginterfaces may range from simple mechanical buttons...
- 10
- 501
- 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx
... Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications ... relate the papers by Sveistrup and Viauet al. also published on JNER this month. Viau et al. com-pare the kinematic strategies of reach, grasp, and placemovements performed with physical and ... abilities, a safe testing and training environment, the opportunity forgraduated exposure to stimuli, the ability to distract oraugment the performer's attention, and perhaps mostimportant to...
- 2
- 360
- 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc
... http://www.adaptiveinformation.net a multi-disciplinaryresearch cluster that brings together researchers in areassuch as wearable computing, sensor technologies, infor-mation retrieval and artificial ... polymers are attractive for sensing in a gar-ment-integrated context because of their ability to retainthe tactile and mechanical properties of a textile-basedstructure. In the garment integration, ... during hand-washingof the foam sensors. This indicates that if the oxidationwere prevented, the sensor would be durable and washa-ble over an indefinite period of time. In a garment-inte-grated...
- 7
- 748
- 0
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx
... potential roles of C 3a and C 5a anaphylatoxins in neu-roprotection by investigating the effects of C 3a and C 5a in parallel with their peptidic analogs, MAP-C 3a and MAP-C 5a on NGF release by astrocytes. ... contaminants in anaphyla-toxin preparations.Analysis of NGF mRNA expression following anaphyla-toxin stimulation was also studied using rat primary astro-cytes analyzed by RPA. We showed that ... C3aR and C5aR, sincestimulation of glial cells by anaphylatoxins can increasecytokine production [24,30,31]. The roles of anaphylatox-ins on brain cells remain ill-characterized and they mayhave...
- 10
- 777
- 0
báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf
... CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCAConsensus CAGGTTAAATATTAGGAGGCTGTAGGCASspI ... Technology) and Organización Panamericana de la Salud (Health Panamer-ican Organization) grant.The authors thank all the persons that kindly collaborated in the revision of the manuscript, particularly ... encodes a protein of 154 amino acids which is a transactivator and has beenassociated with HBV pathogenesis. A change in the amino acid sequences at positions 130 and 131 in the HBV-Xprotein (M130K...
- 10
- 359
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt
... wasinvolved in the study design, analysis and was involved in criticallyreviewing the manuscript. FA and MUC participated in the designed the study and participated in the preparation of the protocol and ... questionnaire and protocol, collection of data and writing the manuscript. MU was involved in the overall supervision,preparation of the questionnaire and collection and analysis of data. TA wasinvolved ... ml (unilateral) and 2695 ml(bilateral). In comparison, the mean drop in the post-op haemoglob in in Group-I was 1.49 gm/dl (unilateral) and 1.94 gm/dl (bilateral), with a mean drainage of 826...
- 5
- 447
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015