báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc
... Tohru: A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology. Journal of NeuroEngineering ... et al., A case study of new assessment and train-ing of unilateral spatial neglect in stroke patients: effect of visual image trans-formation and visual stimulation by using a head mounted display ... cited.Research A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display...
- 8
- 538
- 0
báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx
... analysis of the data regarding adhesion to collagen in the presence of Mg2+ showed that both adrenaline and LPA induced a weak albeit significant decrease in platelet adhesion. Sinceboth LPA and adrenaline ... activators including adenosine 5'-diphosphate(ADP), adrenaline, lysophosphatidic acid (LPA) and ris-tocetin. Collagen, fibrinogen, ADP and adrenaline arephysiological agents that are well-known ... (r2 = 0.49). Data included are from all three separate anti-platelet treatments (ASA and clopidogrel alone as well as ASA and clopidogrel combined).Journal of Translational Medicine 2009, 7:42...
- 14
- 521
- 0
báo cáo hóa học: " An exploratory study to evaluate the utility of an adapted Mother Generated Index (MGI) in assessment of postpartum quality of life in India" potx
... ddhar2001@yahoo.co .in; Swati Sinha - swatisinha21@rediiffmail.com; Vijaylakshmi Bhargava - vl.bhargava@sitarambhartia.org; Aarti Sachdeva - aartisachdeva85@gmail.com; Abhishek Bhartia* - abhishek.bhartia@sitarambhartia.org* ... Vijaylakshmi Bhargava†3, Aarti Sachdeva†2 and Abhishek Bhartia*2Address: 1Department of Pediatrics, Sitaram Bhartia Institute of Science and Research, B-16, Qutab Institutional Area, ... exploratory study to evaluate the utility of an adapted Mother Generated Index (MGI) in assessment of postpartum quality of life in IndiaJitender Nagpal†1,2, Rinku Sen Gupta Dhar†3, Swati Sinha†3,...
- 10
- 613
- 0
Báo cáo hóa học: " Validated instruments used to measure attitudes of healthcare students and professionals towards patients with physical disability: a systematic review" pdf
... disability awarenessand skills training workshop on senior medical students as assessedwith self ratings and performance on a standardized patient case.Teaching & Learning in Medicine ... Characteristics of validated survey instruments tomeasure attitudes of healthcare students and professionals towardspatients with physical disability. Table of the characteristics of Lam et al. Journal of ... EAA contributed to drafting the protocol,designing the search strategy, developing the forms, dataanalysis, and drafting the manuscript. All authors readand approved the final manuscript.Additional...
- 7
- 647
- 0
báo cáo hóa học:" More insights into the immunosuppressive potential of tumor exosomes" pptx
... P,Squarcina P, Accornero P, Lozupone F, Lugini L, Stringaro A, Molinari A, Arancia G, Gentile M, Parmiani G, Fais S: Induction of lym-phocyte apoptosis by tumor cell secretion of FasL-bearingmicrovesicles. ... Spada M, De Milito A, Molinari A, Rivoltini L, Montinaro A, Marra M, Lugini L, Logozzi M, Lozupone F, Federici C, Iessi E, ParmianiG, Arancia G, Belardelli F, Fais S: Effect of proton pump inhibitorpretreatment ... Fais2 and Licia Rivoltini*1Address: 1Unit of Immunotherapy of Human Tumors, Fondazione IRCCS Istituto Nazionale Tumori, Milan, Italy and 2Department of Drug Research and Evaluation, Anti-Tumor...
- 4
- 426
- 0
báo cáo hóa học:" An intron 9 containing splice variant of PAX2" pptx
... TGCCCCCCACTG GCCAGGGAAG CTACCCCACC TCCACCCTGG CAGGAATG GTIntron 9GCCTG g t a g gtgacaatgc tgcagctgcc taatctaggt ggggggaact a aattgtggg tgagctgctg a atggtctgtagtctgaggc tggggtggggggagacacaa cgtcccctcc ... CTGGTTACCC CCCTCACG TGCCCCCCACTG GCCAGGGAAG CTACCCCACC TCCACCCTGG CAGGAATG GTIntron 9GCCTG g t a g gtgacaatgc tgcagctgcc taatctaggt ggggggaact a aattgtggg tgagctgctg a atggtctgtagtctgaggc ... 12 melanoma (8 skin melanoma,4 ocular melanoma) and 12 colon carcinoma patient sam-ples as well as in 9 AML and 5 ALL patients. All leukemiasamples, 11 of the 12 colon carcinoma and 7 of the...
- 6
- 413
- 0
báo cáo hóa học:" Hypoglycemic and beta cell protective effects of andrographolide analogue for diabetes treatment" pot
... mechanisms of action of this promising new anti-diabetic agent arewarranted.Abbreviations A. paniculata: Andrographis paniculata; Andro: androgra-pholide; AL-1: andrographolide-lipoic acid ... purposes)36. Kaneto H, Kajimoto Y, Miyagawa J, Matsuoka T, Fujitani Y, UmayaharaY, Hanafusa T, Matsuzawa Y, Yamasaki Y, Hori M: Beneficial effects of antioxidants in diabetes: possible protection of pancreaticbeta-cells ... isolated for hematoxylin and eosin staining or anti-insulin immuohistaining. A, Representative morphology of pancreatic islets. a- f: hematoxylin and eosin staining. Arrow showed the islets'...
- 13
- 591
- 0
báo cáo hóa học: " Self-efficacy instruments for patients with chronic diseases suffer from methodological limitations - a systematic review" pdf
... University, Baltimore MD, USAEmail: Anja Frei* - anja.frei@usz.ch; Anna Svarin - annasvarin@yahoo.de; Claudia Steurer-Stey - claudia.stey@usz.ch; Milo A Puhan - mpuhan@jhsph.edu* Corresponding author ... character-istics of the self-efficacy scales using standard criteria andanalyzed their development and validation process[11,12].Characteristics of instrumentsAim of instrumentWe distinguished ... that for some majorchronic diseases a substantial number of self-efficacyinstruments are available that cover disease- and task-spe-cific aspects of self-efficacy. For diabetes, substantiallymore...
- 10
- 483
- 0
báo cáo hóa học: " Thai SF-36 health survey: tests of data quality, scaling assumptions, reliability and validity in healthy men and women" pdf
... original SF-36.Tests of scaling assumptionsTests of scaling assumptions determine the appropriate-ness of including an item in a particular scale and thevalidity of using the summated ratings ... Health Transition item was 2.88,indicating that respondents on average rated their healthmarginally worse than a year ago.Tests of scaling assumptionsStandard deviations of items within a ... Sungkanakara C, Assanasen P, Banhiran W, Metheetrairut C:Abstracts 2nd world congress of the world association of sleep medicine (WASM). assessment of quality of life in Thaipopulation with snoring...
- 9
- 574
- 0
Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc
... [38], the AtaxiaFigure 1 Training protocol and study design. Top: Phases of thetraining protocol: Baseline 1 (B1), Robot Training, Baseline 2 (B2),Subject Training, Wash-out. The phases in which ... point to the target, and shifted it later-ally, of three times the maximum lateral deviationobserved in the average baseline trajectory. The ‘average’trajectory was the ‘average’ of all trajectories ... treatment itself but by variation of the clinical scale at the beginning of the therapy.To test the overall effect of adaptive training, we com-pared the primary outcome measures (change in...
- 11
- 596
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quottuyên tập cac bao cao khoa học hội nghị khoa học địa i apos ahoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ