báo cáo hóa học: " A swimming robot actuated by living muscle tissue" docx
báo cáo hóa học: " A swimming robot actuated by living muscle tissue" docx
... between muscle removal from the animal to finalizing the muscle installation into the robotic swimmer was approximately1 hour.Table I: Muscle actuator parameters and swimming robot performance parameters ... andfunctional adaptation of the biological component. Based upon functional performance, muscle ispotentially an excellent mechanical actuator, but the larger challenge of developing muscle- actuated, ... The final tail geometry resulted in sufficientcompliance to allow the tail to assume a sigmoidal shape,with a wave traveling caudally when actuated in water atfrequencies above ~2 Hz. After...
- 9
- 403
- 0
Báo cáo hóa học: " A survey on biometric cryptosystems and cancelable biometrics" docx
... state-of-the-art, commercial vendors, and openissues and challenges. A. Advantages and applicationsBCSs and CB offer several advantages over generic bio-metric systems. Most important advantages are ... element(real-valued feature vectors are required). These inter-vals are encoded and stored as helper data. At the timeof authentication, again, biometric characteristics of a subject are measured and ... that hashes are generated by map-pingeverysinglefeatureagainsttheintervalmatrix.In[80] the authors adopt the proposed fe ature extractionto an online signature hash generation based on a secure...
- 25
- 810
- 0
Báo cáo hóa học: " A new construction on the q-Bernoulli polynomials" docx
... supported by Kyungpook National Universi ty Research Fund, 2010.Author details1Department of Mathematics Education, Kyungpook National University Daegu 702-701, South Korea2Département demathématiques, ... NationalUniversity Daegu 702-701, SouthKoreaFull list of author information isavailable at the end of the articleAbstractThis paper performs a further investigation on the q-Bernoulli polynomials andnumbers ... 2011References1. A ikgöz, M, Erdal, D, Araci, S: A new approach to q-Bernoulli numbers and q-Bernoulli polynomials related to q-Bernstein polynomials. Adv Differ Equ 9 (2010). Article ID 9517642. Carlitz,...
- 6
- 301
- 0
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot
... bknudsen@fhcrc.org; Sandra Cottingham - sandra.cottingham@spectrum-health.org; Ping Zhao - ping.zhao@vai.org; Karl Dykema - karl.dykema@vai.org; Brian Cao - brian.cao@vai.org; James Resau - james.resau@vai.org; ... materialAcknowledgementsWe are grateful to Drs. David Wenkert and Yuehai Shen for 17AAG char-acterization and to Drs. Jacob Zhang and Kyle Furge for statistical analysis. We thank Michelle Bassett for assistance ... 1996,16:1115-1125.28. Arrieta O, Garcia E, Guevara P, Garcia-Navarrete R, Ondarza R,Rembao D, Sotelo J: Hepatocyte growth factor is associatedwith poor prognosis of malignant gliomas and is a predictorfor...
- 13
- 413
- 0
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx
... Yang H, Wang S, Xie S, Liu Q, Liu T,Huang J, Xie W, Li Z, Zhao Y, Wang E, Marincola FM, Yao K: Tran-scriptional patterns, biomarkers and pathways characteriz-ing nasopharyngeal carcinoma of Southern ... cul-ture and expansion. J Transl Med 2006, 4:40.37. Maecker HT, Hassler J, Payne JK, Summers A, Comatas K, GhanayemM, Morse MA, Clay TM, Lyerly HK, Bhatia S, Ghanekar SA, Maino VC,Delarosa C, ... information aboutrelatively stable characteristic of cells and tissues that mayexplain variations among individual patients, or aber-rances between normal and abnormal tissues; messengerRNA informs...
- 10
- 508
- 0
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx
... 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA -A) ,5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA-B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT-GCCAATCTCATCTT-3' ... 5'-GGACGTAGGG-TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT-3' and 5'-AAGACCAGTCCTTGCTGA-3' (β2m), 5'-TAT-AGTCGACCACCCGGACTCAGAATCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' ... HLA-B. The primer sequences were: 5'-GAGA-CATCTTGGAACTGGAC-3' and 5'-CTCTGAGTGA-GAATCTGAGC-3' (forward and reverse, TAP1), 5'-GTACAACACCCGCCATCAG-3' and 5'-GGACGTAGGG-TAAACGTCAGC-3'...
- 13
- 529
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... 360(9331):427-435.14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M,Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take-shita S: Unblinded pilot study of autologous transplantation ... ShimadaK, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patientswith limb ischaemia by autologous transplantation of bone-marrow cells: a pilot study and a randomised controlled trial.Lancet ... pathological neovascularization. Circ Res1999, 85(3):221-228.13. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S,Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, ShimadaK,...
- 9
- 773
- 0
báo cáo hóa học:" A comparison of classification methods for predicting Chronic Fatigue Syndrome based on genetic data" potx
... data as testing data and different nine-tenths ofthe data as training data. Finally, the average estimate overall runs was reported by running the above regular 10-foldcross-validation for 100 ... adopted AUC forevaluating predictive ability of classifiers owing to the factthat AUC is a better performance metric than accuracy[31]. In this study, AUC was used as a value to comparethe ... Syndrome based on genetic dataLung-Cheng Huang†1,2, Sen-Yen Hsu†3 and Eugene Lin*4Address: 1Department of Psychiatry, National Taiwan University Hospital Yun-Lin Branch, Taiwan, 2Graduate...
- 8
- 598
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... sepsis.Intensive Care Med 2001, 27:1412-1415.24. Martinez A, Orozco G, Varade J, Sanchez LM, Pascual D, Balsa A, Gar-cia A, de la Concha EG, Fernandez-Gutierrez B, Martin J, Urcelay E:Macrophage migration ... malarial anemia. JInfect Dis 2009, 200:629-637.36. Dhanantwari P, Nadaraj S, Kenessey A, Chowdhury D, Al-Abed Y,Miller EJ, Ojamaa K: Macrophage migration inhibitory factorinduces cardiomyocyte ... genotyping assay.References1. Baugh JA, Bucala R: Macrophage migration inhibitory factor.Crit Care Med 2002, 30:S27-S35.2. Calandra T, Roger T: Macrophage migration inhibitory factor: a regulator...
- 8
- 554
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttataSElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaaSElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaacSeo et al. ... (’5to3’)SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaataSED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaataSEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaataSEG ... gcgcggatcctcaagttgtgtataaataSEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaagaSEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacataSElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
Từ khóa: báo cáo khoa họcbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật