0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: " Energy expenditure in chronic stroke patients playing Wii Sports: a pilot study" pot

Báo cáo hóa học:

Báo cáo hóa học: " Energy expenditure in chronic stroke patients playing Wii Sports: a pilot study" pot

... maintainhealth, according to the American College of SportsMedicine and American Heart Association (ACSM/AHA) Guidelines on physical activity and public health[20]. Practical advantages of exergaming include ... participant safety and safehandling of measurement equipment, two researchersstood beside the participants during Wii game play.Data analysisMean (± standard deviati on) VO2was calculated ... JO, King AC, Macera CA,Castaneda-Sceppa C: Physical activity and public health in older adults:recommendation from the American College of Sports Medicine and theAmerican Heart Association....
  • 7
  • 286
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Oromotor variability in children with mild spastic cerebral palsy: a kinematic study of speech motor control" docx

... dividingthe standard deviation of kinematic data by the meankinematic data. Larger CV indicates higher variability ofkinematic data in speech tasks.Statistical AnalysisGroup differences in age were ... thismanuscript. HCC participated in the experimental setup of kinematicanalysis, kinematic data collection and analysis, and revising of thismanuscript. WHH carried out the kinematic data collection ... collection and analysis. FGYparticipated in the data interpretation and the revising of this manuscript.LYY carried out the data collection and analysis. CYW carried out the datacollection and interpretation....
  • 10
  • 421
  • 0
báo cáo hóa học:

báo cáo hóa học:" Inflammatory mechanisms in ischemic stroke: therapeutic approaches" potx

... H, Nakagawa R, TakadaI, Iwaki T, Okada Y, Iida M, Cua DJ, Iwakura Y, Yoshimura A: Pivotalrole of cerebral interleukin-17-producing γδT cells in thedelayed phase of ischemic brain injury. Nat ... stroke has become an impor-tant area of research in translational medicine.Cytokines and brain inflammationCytokines are a group of small glycoproteins that are pro-duced in response to an ... directcell damage, regional brain I/R induces an inflammatoryresponse involving complement activation and genera-tion of active fragments such as C 3a and C 5a anaphylatox-ins. Expression of C 3a and...
  • 11
  • 510
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

... 5'-TGAGGAGGTCCGAGTTCTTG-3'FOS F: 5'-CAAGCGGAGACAGACCAAC-3'R: 5'-GAGCTGCCAGGATGAACTC-3'HSPB8 F: 5'-AGCCAGAGGAGTTGATGGTG-3'R: 5'-TGCAGGAAGCTGGATTTTCT-3'GAPDH ... 5'-AGCCCTACGAGCACCTGAC-3'R: 5'-AGCGGCCAGTATAGGTGATG-3'PDK4 F: 5'-GTCCCTACAATGGCACAAGG-3'R: 5'-GGTTCATCAGCATCCGAGTAG-3'JUN F: 5'-GAGCGGACCTTATGGCTACA-3'R: ... samples. Themicroarray experiment and the analysis of array data were carried out by AlmacDiagnostics, Craigavon, N. Ireland. PMW was responsible for the annotation ofthe microarray data and...
  • 11
  • 616
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Dynamic changes in cellular infiltrates with repeated cutaneous vaccination: a histologic and immunophenotypic analysis" pot

... exploring the advantages of nanoparticu-late antigen systems in humans offer an interestingalternative to intramuscular, dermal and subcutaneousvaccination [ 47]. Using this approach, immunogenicitycould ... PLX4032, a highly selectiveV600EBRAF kinase inhibitor: Clinical correlation of activity withpharmacokinetic and pharmacodynamic parameters in a phase I trial. JClin Oncol (Meeting Abstracts) ... sadjuvant, with or without peptide, in a clinical trial of a melanoma vaccine. We show data assessing whether: (a) 1-3 injections would induce perivascular dermal lym-phoid aggregates, with accumulation...
  • 13
  • 339
  • 0
báo cáo hóa học:

báo cáo hóa học: " Complement activation in the Parkinson''''s disease substantia nigra: an immunocytochemical study" ppt

... for Parkinson's Research, and by a donation from Marcia and Howard Parven.References1. Beal MF: Mitochondria, oxidative damage, and inflammation in Parkinson's disease. Ann NY Acad ... and C9+ melanized neurons hadfew remaining melanin granules. No cellular staining waspresent in negative controls, although faint vascular stain-ing was observed in a few specimens. Staining ... P, Inagaki H, Minami M,Nagatsu T: Interleukin-1 beta, interleukin-6, epidermalgrowth factor and transforming growth factor-alpha are ele-vated in the brain from parkinsonian patients. Neurosci...
  • 8
  • 338
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Sleep quality in mechanically ventilated patients: comparison between NAVA and PSV modes" doc

... at a s ampling rate of 100Hz, recorded by a dedicated software (Nava Tracker V.2.0, Maquet Critical Care, Sölna, Sweden), and an ana-lyzer using software Analysis V 1.0 (Maquet CriticalCare) ... becausehyperventilation and patient ventilator asynchrony mayresult from PSV as well a s ACV in mechanically venti-lated ICU patients [17]. Fanfulla et al. [18] comparedtwo ventilatory settings in nine patients ... whereas we observed the EAdi signal.Parthasarathy and Tobin [15] found a lower rate ofsleep fragmentation during ACV compared with PSV.This was explained by the central apneas induced byover-assistance...
  • 8
  • 301
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx

... ORF located in 8~26 ACCTCTGCCTAATCATCTC X/preC40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein1450~1469 ... CCTGCTGGTGGCTCCAGTTC pre-S21571~1592 TCCTAGGACCCCTGCTCGTGTT S1657~1679 ACTTCTCTCAATTTTCTAGGGGG S2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT RT3199~3221 CACCAGCACCATGCAACTTTTT ... using commerciallyavailable kits (QIAamp DNA Blood Mini Kit, QIAGEN,Inc., Valencia, CA).Polymerase chain reactionFull length amplificationThe PCR was performed in a 96-well cycler (GeneAmpPCR...
  • 7
  • 566
  • 0
báo cáo hóa học:

báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt

... ZimbabweDemographic and Health Survey 1999 Calverton, Maryland: Central StatisticalOffice and Macro International Inc; 2000.19. National Bureau of Statistics [Tanzania] and Macro International ... Trichomonas vaginal is, bacterial vaginosis andcandidiasis.Statistical analysisData were entered and analyzed using STATA Version10 from StataCorp, Texas, USA. Distribution of risk fac-tors ... [Tanzania] and ORC Macro: TanzaniaDemographic and Health Survey 2004-05 Dar es Salaam, Tanzania: NationalBureau of Statistics and ORC Macro; 2005.22. Chapman R, White RG, Shafer LA, Pettifor A, ...
  • 9
  • 449
  • 0
báo cáo hóa học:

báo cáo hóa học:" Plasma cytokines in women with chronic fatigue syndrome" doc

... chronic intestinal inflammation [24,25].The unchanged IL-17 and IL-23 levels in CFS noted in thisstudy would argue against bacterial gastrointestinal infec-tions as playing an important role in ... diagnosis and assessment; ZB participated in subject recruitment and data management; XRZ carriedout the immunoassays. All authors read and approved thefinal manuscript.Additional materialAcknowledgementsThis ... ofthe individual Kruskal-Wallis analyses are shown in Table1.Pro- inflammatory cytokines A significant elevation in the relative amounts of 4 of 5pro-inflammatory cytokines in peripheral blood...
  • 8
  • 496
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quothoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcbáo cáo y họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM