Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... Walker3AbstractBackground: The complex data sets generated by higher-order polychromatic flow cytometry experiments are a challenge to analyze. Here we describe Exhaustive Expansion, a data ... as: Siebert et al.: Exhaustive expansion: A novel technique for analyzing complex data generated by higher-order polychromatic flow cytometry experiments. Journal of TranslationalMedicine 2010 ... 70:1362-1364.18. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H,Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T,Imaizumi T: Therapeutic angiogenesis for patients...
- 15
- 476
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT AH1 GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
- 24
- 604
- 0
Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx
... Drachman Hall, 1295 N. Martin Avenue, Tucson, Arizona, USA, 2Tucson Fire Department, Health and Safety, 421 South Church, Tucson, Arizona, USA and 3Lunda and Associates, 1636 North Swan, ... Functional Movement ScreenData was coded using Stata 8.0. For exploratory data anal-ysis we used bivariate methods. The primary hypothesiswas assessed with multivariate analysis (logistic and ... were gathered by the organization'sworker's compensation department. The data was derivedfrom personnel, absentee and medical records for a one-year period.Statistical AnalysesPart...
- 9
- 468
- 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
... better. For example, if the allpass VFD filter is designed again withp∈ [−0.65, 0.35] for both LS design and minimax design, the absolute errors of group-delay for LS design and minimax design are ... Group-Delay Error Design of Allpass Variable Fractional-Delay Digital FiltersCheng-Han Chan,1Soo-Chang Pei (EURASIP Member),2 and Jong-Jy Shyu31Department of Aviation and Communication Electronics, ... CorporationEURASIP Journal on Advances in Signal ProcessingVolume 2010, Article ID 976913, 10 pagesdoi:10.1155/2010/976913 Research Article A New Method for Least-Squares and Minimax Group-Delay Error...
- 10
- 490
- 0
Báo cáo sinh học: "Research Article Monotone Iterative Technique for First-Order Nonlinear Periodic Boundary Value Problems on Time Scales" ppt
... J. J. Nieto, “The monotone iterative technique for three-point second-orderintegrodifferential boundary value problems with p-Laplacian,” Boundary Value Problems, vol. 2007, Article ID 57481, ... parameter on time scales,” Nonlinear Analysis: Theory, Methods & Applications, vol. 70, no. 3, pp. 1133–1145, 2009.10 S T. Wu and L Y. Tsai, Periodic solutions for dynamic equations on time ... boundary value problems on time scales,” Computers &Mathematics with Applications, vol. 48, no. 3-4, pp. 637–648, 2004.5 P. Stehl´ık, Periodic boundary value problems on time scales,”...
- 10
- 336
- 0
Báo cáo sinh học: " Research Article Global Optimal Regularity for the Parabolic Polyharmonic Equations" pptx
... ProblemsVolume 2010, Article ID 879821, 12 pagesdoi:10.1155/2010/879821 Research Article Global Optimal Regularity for the Parabolic Polyharmonic EquationsFengping YaoDepartment of Mathematics, Shanghai ... in the theory of partial differential equations, are two fundamental estimates for elliptic and parabolic equations and the basis for the existence, uniqueness, and regularity of solutions. The ... show the global regularity estimates for the following parabolic polyharmonic equationut−Δmu f in Rn× 0, ∞,m ∈ Zunder proper conditions. Moreover, it will be verifiedthat these...
- 12
- 335
- 0
Báo cáo sinh học: " Research Article A Hierarchical Estimator for Object Tracking" pot
... that is, a camera pair. The local estimateperformed its Kalman filter with the estimated state and theKalman gain was updated. Each output of the local estimator was sent to the global estimator. ... con-sists of Local Estimator and Global Estimator, as shownin Figure 1. Local Estimator uses data association and theKalman filter for estimating the 3D position of the object using a camera pair. It ... the camera pair. Every two views form a camera pairand are applied to a local estimator for observations.The direct linear transform (DLT) [27] is adopted as thereconstruction method for each...
- 11
- 317
- 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx
... capture the information in each of the negatives of a large collectionbefore the damage causes a complete and irretrievable loss of information.2.1. Restoration Approaches. The primary approach ... development and analysis of a new image-based photonegative restoration system. Deteriorated acetate-based safety negatives are complex objects due to the separation and channeling of their multiple layers ... cost-effective camera and LCD system that are already available to most libraries and museums. An initial analysis is provided to show the accuracy of this method and promising results of restoration of actual...
- 13
- 569
- 0
Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt
... as a parameter available for real-time control, sothat a biologist viewing a periodicity characterization of a sequence might subjectively assign a relative weight to each of the autocorrelation ... Silverman and R. Linsker, A measure of DNA periodic-ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300,1986.[23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya,and ... dinucleotide periodicity, as discussed above for TATA tetramers. In this example, the hybrid autocorrelation-IPDFT result is biased towards the IPDFT, as a result of the IPDFT having a largerdynamic range...
- 8
- 382
- 0
Báo cáo hóa học: " Research Article A MAP Estimator for Simultaneous Superresolution and Detector Nonunifomity Correction" ppt
... Fla, USA, April 1997.[9] Y M. Chiang and J. G. Harris, “An analog integrated circuit for continuous-time gain and offset calibration of sensor arrays,”Analog Integrated Circuits and Signal Processing, ... (MAP) estimation framework for simultaneously addressing undersampling, linear blur, additivenoise, and bias nonuniformity. In particular, we jointly estimate a superresolution (SR) image and ... These include simulated imagery for quantitative analysis and real infrared video for qualitative analysis.Copyright © 2007 R. C. Hardie and D. R. Droege. This is an open access article distributed...
- 11
- 331
- 0
Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx
... cycles6.577.588.599.51010.5ENOBProposed calibration Standard calibration Without calibration Figure 12: Transient evolution of the ENOB during calibration (same filter for standard and proposed calibration) .Table 2: Precision performance ... comparesour technique with other proposed techniques which addressthe same problem.2. STANDARD DIGITAL BACKGROUND CALIBRATION A pipeline ADC is composed of a cascade of stages that per-form an ... Vogel A modification of the background digital calibration procedure for A/ D converters by Li and Moon is proposed, based on a methodto improve the speed of convergence and the accuracy of the calibration. ...
- 11
- 398
- 0
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx
... Open AccessAdrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapyAlexandra Ahmet1*, Harold Kim2,3 and ... in the diagnosis and management of asthma over the past decade, as wellas the availability of comprehensive and widely-acceptednational and international clinical practice guidelines forthedisease[6,7],asthmacontrolinCanadaremainssuboptimal. ... Spier4Abstract Inhaled corticosteroids (ICSs) are the most effective anti-inflammatory agents available for the treatment of asthma and represent the mainstay of therapy for most patients with the...
- 12
- 774
- 0
báo cáo khoa học: "MeRy-B: a web knowledgebase for the storage, visualization, analysis and annotation of plant NMR metabolomic profiles" potx
... other availablelibraries.ConclusionMeRy-B is a web- based application and database for the management and analysis of NMR plant metabolomicsprofiles, filling the gap in centralized informat ... spectra available in the MeRy-B knowledgebase. Construction and ContentStandards for metabolomicsData storage and database building tools are required for the storage and analysis of present and ... inte-grat ed tools for data management, analysis and metabo-lite identification. MeltDB [36] and SetupX [37], two web- based software platforms for the systematic storage, analysis and annotation of...
- 12
- 368
- 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt
... stable and are easily a ordable. It may also be useful to test the eff ect of EGCG or GTPs in combination with other phytochemicals that have anti-infl ammatory activi-ties. Additionally, GTPs ... anakinra, to antagonize IL-1 (IL-1α and IL-1β) activity is a US Food and Drug Administration approved therapy for the treatment of rheumatoid arthritis but not for OA due to its limited and ... Dermatol 2009, 129:1258-1270.doi:10.1186/ar3428Cite this article as: Katiyar SK, Raman C: Green tea: a new option for the prevention or control of osteoarthritis. Arthritis Research & Therapy...
- 2
- 338
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ